We narrowed to 169,217 results for: addgene
-
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh2
Plasmid#132710PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Crh geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-TIRAP-cGASΔN-HA
Plasmid#130921PurposeExpresses human cGASΔN (aa160-522)-HA with an N terminal fusion of the TIRAP N terminus (aa1-85); Puromycin selection markerDepositorInsertTIRAP-ΔNcGAS
TagsHAExpressionMammalianMutationcGAS N terminus (aa1-159) replaced with the N ter…PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Fyn-cGASΔN-HA
Plasmid#130922PurposeExpresses human cGASΔN (aa160-522)-HA with an N terminal fusion of the Fyn dual acylation motif (aa1-16); Puromycin selection markerDepositorInsertFyn-ΔNcGAS
TagsHAExpressionMammalianMutationcGAS N terminus (aa1-159) replaced with the dual …PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna6-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128341PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2 Met133, 138, 186 to Ileu
Plasmid#127269PurposeFor in vitro translation of ELL2 with with internal HA tag and Met133, 138, 186 IleuDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu HA tag after M186PromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
Plasmid#127271PurposeFor in vitro translation of human ELL2 with Met133, 138, 186 to Ileu with HA tag after 8th MetDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu with HA tag after 8th MetPromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
frameshift ELL2
Plasmid#127257PurposeFor in vitro translation of human a frameshift ELL2 that results in a 58 kDa product from internal initiation.DepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationXhoI site between the 1st &2nd Met was filled…PromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only