We narrowed to 1,262 results for: mKate

#199481

Site directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTC

Robert Bryson-Richardson

Miles et al Nat Commun. 2024 Jun 12;15(1):5011. doi:

July 12, 2023

Academic Institutions and Nonprofits only

#105964

heat shock inducible transgenesis, primary cillium marker

Caren Norden

Icha et al J Cell Biol. 2016 Oct 24;215(2):259-275.

Feb. 15, 2018

Academic Institutions and Nonprofits only

#80828

P2A followed by mKate2 without pA

Philip Washbourne

Fowler et al PLoS One. 2016 Aug 8;11(8):e0159277. doi

Nov. 1, 2016

Academic Institutions and Nonprofits only

#109529

Muscle specific zebrafish expression of mKate2 fused to Rac1

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#109546

Multisite gateway vector for expression of mKate2 fused to the 5' signal sequence from calreticulin and 3' KDEL ER retention sequence (marks the ER, or ER/SR in muscle)

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#109530

Muscle specific zebrafish expression of mKate2 fused to dominant negative Rac1

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#69105

Expresses mKate2 (codon adapted for Streptococcus pneumoniae); under control of CSP inducible promoter PssbB. Plasmid integrates in S. pneumoniae bgaA locus by double cross-over.

Jan-Willem Veening

Beilharz et al Appl Environ Microbiol. 2015 Aug 7. pii:

April 27, 2016

Academic Institutions and Nonprofits only

#105950

heat shock inducible transgenesis

Caren Norden

Strzyz et al Dev Cell. 2015 Jan 26;32(2):203-19. doi:

Feb. 14, 2018

Academic Institutions and Nonprofits only

#154282

Entry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; WT)

Suzanne Walker

Levine et al Proc Natl Acad Sci U S A. 2021 Jan 26;11

Nov. 16, 2020

Academic Institutions and Nonprofits only

#208765

To express C2m2-mKate in bacteria

Urte Neniskyte

Dirvelyte et al Cell Mol Biol Lett. 2023 Jul 27;28(1):59

Oct. 26, 2023

Academic Institutions and Nonprofits only