Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 13 of 13 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...GGTCTCTCGCAGGATGTTGC 47931 cut S. pyogenes 23918387 Chen mKate synthetic ATGAGAATCAAGGCGGTCGA 62715 cut S. pyogenes...
  2. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression LSSmKate1 463 624 3 3.2 1.7 hr Monomer pLSSmKate1-N1 - Mammalian Expression pLSSmKate1-C1 - Mammalian...pBAD/HisD-LSSmKate1 - Bacterial Expression LSSmKate2 460 605 4 2.7 2.5 hr Monomer pLSSmKate2-N1 - Mammalian...Expression PAmKate 568 628 5 5.6 19 min Monomer pPAmKate-N1 - Mammalian Expression pBAD/HisB-PAmKate - Bacterial...dKatushka-pBAD - Bacterial Expression mKate1.3 588 635 25 Monomer mKate1.31-pBAD - Bacterial Expression mPlum...Mammalian Expression pBAD/HisD-LSSmKate2 - Bacterial Expression LSSmKate2-C1 - Mammalian Expression Jump...
  3. Control AAV Preps

    Type
    Collection
    ...105921 pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Patrick 105922 pAAV-CBh-mKate2-IRES-MCS (... (C-gap-WT) CBh mKate2 Constitutive 2 Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive...
  4. Brain Initiative Collection

    Type
    Collection
    ...axon-GCaMP6s-P2A-mKate2 For enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian...pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 For co-expression of GCaMP6s with mKate2 Lin Tian 112007-AAV9 pAAV-hSynapsin1...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...105970 hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS Caren Norden 105971 pME mKate2-dynactin1-811...811 DCTN1 mKate2 ALS Caren Norden 106093 pFRT_TO_FlagHA_TIA1 TIA1 Flag, HA CMV ALS Thomas Tuschl 106094...
Showing: 1 - 13 of 13 results