We narrowed to 15 results for: mKate
-
TypeBlog Post...fluorophores like DsRed from Discosoma sp. and Katushka/mKate from Entacmaea quadricolor. With his discoveries...
-
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...fluorescent proteins like TagRFP, tdTomato, DsRed, the mKate series, or tdKatushka2 (Drobizhev et al. 2011) ... -
Validated gRNA Sequences
TypeCollection...GGTCTCTCGCAGGATGTTGC 47931 cut S. pyogenes 23918387 Chen mKate synthetic ATGAGAATCAAGGCGGTCGA 62715 cut S. pyogenes... -
Hot Plasmids - June 2019 - Optogenetics, Acoustic Reporter Genes, microRNAs, and the CRISPR-Cas9 system CHIME
TypeBlog Post... and thus a marker for transfection. The other (mKate2) is regulated in the 3’ UTR by four miRNA target...miRNA is present, it will repress expression of mKate2 relative to EBFP2. Weiss’s group used these reporters... -
Hot Biosensors 2022: Year-End Roundup
TypeBlog Post...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mKate2 (AAV9) pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 (AAV9) pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post...coral mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies...retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2 as the fluorophores; mOrange2 is the default state... -
Which Fluorescent Protein Should I Use?
TypeBlog Post...light. For example, T-Sapphire, LSSmOrange, and LSSmKate. Fluorescent Sensors: These FPs change their excitation... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...highly photostable fluorophores mOrange2, EGFP, and mKate2 (red) to solve the problematically low fluorescent... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...dKatushka-pBAD - Bacterial Expression mKate1.31 (aka mKate2) 588 635 25 Monomer mKate1.31-pBAD - Bacterial Expression...Expression LSS-mKate1 463 624 2.5 3.2 100 min Monomer pLSSmKate1-N1 - Mammalian Expression pLSSmKate1-C1 - Mammalian...pBAD/HisD-LSSmKate1 - Bacterial Expression LSSmKate2 460 605 4.4 2.7 2.5 h Monomer pLSSmKate2-N1 - Mammalian...Expression PAmKate 568 628 405 5 5.6 19 min Monomer pPAmKate-N1 - Mammalian Expression pBAD/HisB-PAmKate - Bacterial...Mammalian Expression pBAD/HisD-LSSmKate2 - Bacterial Expression LSSmKate2-C1 - Mammalian Expression Return... -
Brain Initiative Collection
TypeCollection...axon-GCaMP6s-P2A-mKate2 For enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian...pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 For co-expression of GCaMP6s with mKate2 Lin Tian 112007-AAV9 pAAV-hSynapsin1... -
Fluorescent Proteins: FRET
TypeCollection...LSSmOrange* mKate2 437 0.45 633 62,500 0.40 5.6 3.7 pLSSmOrange-N1 , mKate1.31-pBAD , pLSSmOrange-mKate2 LSSmOrange... -
AAV Molecular Tools
TypeCollection...pAAV-DIO-EF1α-mKate2-PDE4D3-Cat EF1a-driven, Cre-dependent Cre-dependent expression of mKate2 and a truncated... -
Control AAV Preps
TypeCollection...1 Karl Deisseroth 105921 pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Marcella Patrick 114469... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Expresses pHluorin-mKate2-hLC3 (PK-hLC3) for monitoring autophagy A Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent... -
Neurodegeneration Plasmid Collection
TypeCollection...Parkinson's Hilal Lashuel 105970 hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS, motor neuron disease Caren...Caren Norden 105971 pME mKate2-dynactin1-811 DCTN1 mKate2 ALS, motor neuron disease Caren Norden 106093...