Validated gRNA Sequences
Type
Collection
...GGTCTCTCGCAGGATGTTGC 47931 cut S. pyogenes 23918387 Chen mKate synthetic ATGAGAATCAAGGCGGTCGA 62715 cut S. pyogenes...
We narrowed to 8 results for: mKate
-
-
Fluorescent Protein Guide: Empty Backbones
TypeCollection...dKatushka-pBAD - Bacterial Expression mKate1.31 (aka mKate2) 588 635 25 Monomer mKate1.31-pBAD - Bacterial Expression...Expression LSS-mKate1 463 624 2.5 3.2 100 min Monomer pLSSmKate1-N1 - Mammalian Expression pLSSmKate1-C1 - Mammalian...pBAD/HisD-LSSmKate1 - Bacterial Expression LSSmKate2 460 605 4.4 2.7 2.5 h Monomer pLSSmKate2-N1 - Mammalian...Expression PAmKate 568 628 405 5 5.6 19 min Monomer pPAmKate-N1 - Mammalian Expression pBAD/HisB-PAmKate - Bacterial...Mammalian Expression pBAD/HisD-LSSmKate2 - Bacterial Expression LSSmKate2-C1 - Mammalian Expression Return... -
Brain Initiative Collection
TypeCollection...axon-GCaMP6s-P2A-mKate2 For enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian...pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 For co-expression of GCaMP6s with mKate2 Lin Tian 112007-AAV9 pAAV-hSynapsin1... -
Fluorescent Proteins: FRET
TypeCollection...LSSmOrange* mKate2 437 0.45 633 62,500 0.40 5.6 3.7 pLSSmOrange-N1 , mKate1.31-pBAD , pLSSmOrange-mKate2 LSSmOrange... -
AAV Molecular Tools
TypeCollection...pAAV-DIO-EF1α-mKate2-PDE4D3-Cat EF1a-driven, Cre-dependent Cre-dependent expression of mKate2 and a truncated... -
Control AAV Preps
TypeCollection...1 Karl Deisseroth 105921 pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Marcella Patrick 114469... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Expresses pHluorin-mKate2-hLC3 (PK-hLC3) for monitoring autophagy A Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent... -
Neurodegeneration Plasmid Collection
TypeCollection...Parkinson's Hilal Lashuel 105970 hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS, motor neuron disease Caren...Caren Norden 105971 pME mKate2-dynactin1-811 DCTN1 mKate2 ALS, motor neuron disease Caren Norden 106093...