We narrowed to 15,903 results for: grna
-
Plasmid#131503PurposeEndogenous tagging of Arp2/3 complex subunit 5: C-terminal (amino acid position: STOP codon)DepositorAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pEM040 [Multiome Perturb-seq sgRNA expression vector]
Plasmid#224898PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNA, engineered for high-efficiency ID assignment in Multiome Perturb-seq experimentsDepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2515
Plasmid#91083PurposeModule C, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAtU6Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pS148∙CsR
Plasmid#197858PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Ap/Cb resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT42
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn2a-3xV5-EF1-smFP-flag
Plasmid#182561PurposeFor mouse Nav1.2 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn2a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available sinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p201H Cas9
Plasmid#59176PurposeCas9 driven by double 35S, hygromycin resistance for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
hph
UseCRISPRPromoter2x35S and StUbi-3PAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
ExpressionMammalianAvailable sinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT56
Plasmid#223428PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMga#2/Cre
Plasmid#173602PurposeExpresses a Mga-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Mga (Mga Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDnmt3a#2/Cre
Plasmid#173588PurposeExpresses a Dnmt3a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dnmt3a (Dnmt3a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#2/Cre
Plasmid#173608PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#1/Cre
Plasmid#173607PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_2
Plasmid#101075PurposeEncodes gRNA for 3' target of human KMT2BDepositorPublicationInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_1
Plasmid#101074PurposeEncodes gRNA for 3' target of human KMT2BDepositorPublicationInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only