We narrowed to 15,623 results for: grna
-
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn2a-3xV5-EF1-smFP-flag
Plasmid#182561PurposeFor mouse Nav1.2 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn2a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p201H Cas9
Plasmid#59176PurposeCas9 driven by double 35S, hygromycin resistance for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
hph
UseCRISPRPromoter2x35S and StUbi-3PAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT56
Plasmid#223428PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMga#2/Cre
Plasmid#173602PurposeExpresses a Mga-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Mga (Mga Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDnmt3a#2/Cre
Plasmid#173588PurposeExpresses a Dnmt3a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dnmt3a (Dnmt3a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#2/Cre
Plasmid#173608PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#1/Cre
Plasmid#173607PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS148∙CsR
Plasmid#197858PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Ap/Cb resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_2
Plasmid#101075PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_1
Plasmid#101074PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
Plasmid#154429Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmidDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
UseCRISPR and LentiviralExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_3x_U6_Cldn5_CAG_nlsTagBFP2
Plasmid#247679PurposeTargeting Cldn5 gene in vivo by adeno-associated viral vector-mediated deliveryDepositorInsertCldn5 sgRNAs
UseAAV, CRISPR, and Mouse TargetingTagsnls-TagBFP2ExpressionMammalianPromoterU6Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV073
Plasmid#247962PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to target the uidA gene in the DIVERSIFY gene landing platform. pyrG markerDepositorInsertCas9-AMA1-uidA-gRNA-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV1068
Plasmid#247976PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to restore nkuA in Aspergillus nidulans. argB markerDepositorInsertCas9-AMA1-nkuA-gRNA-argB-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV1067
Plasmid#247975PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to restore nkuA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-nkuA-gRNA-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDIV069
Plasmid#247966PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to target the IS1 locus where the DIVERSIFY gene landing platform is integrated in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-IS1-gRNA-pyrG-ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only