We narrowed to 6,100 results for: tTA
-
Plasmid#45865DepositorAvailable SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pCRII-Topo Chn2 in situ probe
Plasmid#45625DepositorInsertChn2 in situ probe (Chn2 Mouse)
UseIn situMutationfragment contains bp# 2212-2619 of BC051139.1Available SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Inhba
Plasmid#45868DepositorInsertInhba in situ probe (Inhba Mouse)
UseIn situMutationnt 428-933 from Inhba mRNA (NM_008380.1)Available SinceJune 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-FCRL3-3xFLAG-puro
Plasmid#248155PurposeLentiviral vector expressing human FCRL3 with 3xFLAG tagsDepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralTags3x FLAGMutationA 3xFLAG epitope tag is fused in frame to the C-t…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUS LC 8Y->S
Plasmid#226606Purpose8 tyrosines to serineDepositorInsertFUS LC 8Y->S (FUS Human)
Tags6HisExpressionBacterialMutation8 tyrosines to serinePromoterT7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-NHP.RMA-IRES-EGFP
Plasmid#227886PurposeExpresses Gluc-NHP.RMA and EGFP under the hSyn promoter. Gluc-NHP.RMA for monitoring neuronal transduction.DepositorInsertsGaussia luciferase fused to macaque Fc
IRES-EGFP
UseAAV and LuciferaseTagsGluc and IgG1 FcExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVeBtA3
Plasmid#238988PurposeMammalian expression of bovine arrestin-3 short isoform with Venus N-terminal fusionDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVeBtA2-3A
Plasmid#238991PurposeMammalian expression of mutant bovine arrestin-2 long isoform with Venus N-terminal fusionDepositorInsertarrestin-2 long (ARRB2 Bovine)
TagsVenusExpressionMammalianMutationI386A,V387A,F388APromoterCMVAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP/VSVG-rbPodxl
Plasmid#233260PurposeExpression of EGFP-tagged PODXL WTDepositorInsertPODXL (PODXL Rabbit)
UseLentiviralAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-2pro and NbATML1-1pro
Plasmid#231155PurposeT-DNA encoding TRV2 with mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertmobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Camk2d sgRNA6
Plasmid#220118PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Camk2d intron6 5' splice site by U6 promoterDepositorInsertTadA8e, nSauriCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-Sauri-U6-Camk2d sgRNA6
Plasmid#220122PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron6 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauriCas9
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL562
Plasmid#231162PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlCHL1DepositorInsertmobile gRNA targeting SlCHL1
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
p40651-EFSNS-FMR1_e1-24xms2
Plasmid#222968PurposeMS2 mRNA reporter with intact FMR1 5' UTR and exon 1 sequenceDepositorInsertFMR1-31CGG 5' UTR and exon1
ExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA1-EGFP
Plasmid#226002PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a Di-iPGM
Plasmid#180241PurposeBacterial expression plasmid for production of recombinant Dirofilaria immitis iPGM His10DepositorInsertDirofilaria immitis iPGM-10His
TagsHisExpressionBacterialPromoterT7Available SinceOct. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-PODXL S481D
Plasmid#195224PurposeMammalian expression vector containing GFP tagged Podocalyxin. PKC phosphomimetic mutant.DepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only