We narrowed to 4,358 results for: PRS;
-
Plasmid#240604PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 1 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-DeltaC4
Plasmid#240609PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2 likely at Cluster 4 of ACE2 in the collectrin-like site. The whole C4 sequence was deleted in this mutantDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationdeletion of the full Cluster 4 sequence on ACE2 (…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C0
Plasmid#240603PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 0 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C3
Plasmid#240607PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 3 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
LSAM domain expression plasmid
Plasmid#240215PurposePlasmid for the recombinant expression of the LSAM domain of human legumain in E. coli.DepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO934
Plasmid#235766PurposeExpression of ScVPS34 delta CBR1 L31-D55-3xFLAG undeer its own promoterDepositorInsertVPS34 delta CBR1
Tags3xFLAGExpressionYeastMutationaa 31-55 deletedPromoterScVPS34 promoterAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO760
Plasmid#235759PurposeExpression of ScVPS38 delta C2 (1-154)-x3FLAG under its own promoterDepositorInsertVPS38 delta C2
Tags3xFLAGExpressionYeastMutationaa 1-154 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO765
Plasmid#235762PurposeExpression of ScVPS38 delta C2 (1-154) -EGFP under its own promoterDepositorInsertVPS38
TagsEGFPExpressionYeastMutationaa 1-154 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO932
Plasmid#235764PurposeExpression of ScVPS34 HELCAT (268-875)-3xFLAG under its own promoterDepositorInsertVPS34 HELCAT
Tags3xFLAGExpressionYeastMutationaa 268-875PromoterScVPS34 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1920
Plasmid#235767PurposeProtein expression of ScVPS34 untagged + ScVPS15 S622D_H623E_T626E-ZZ in yeastDepositorArticleTags3xTEV-ZZExpressionYeastMutationS622D, H623E, T626E and ScVPS15 S622D_H623E_T626EPromoterGAL-TDH3Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPI486
Plasmid#207441Purpose6xHis-SS-TEV-ErkB bacterial expression vectorDepositorInsertErkB
UseUnspecifiedAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPI580
Plasmid#207445Purpose6xHis-SS-TEV-ErkA bacterial expression vectorDepositorInsertErkA
UseUnspecifiedAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPI544
Plasmid#207443Purpose6xHis-SS-TEV-ErkB-ErkB-T176A bacterial expression vectorDepositorInsertErkB
UseUnspecifiedMutationT176AAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPI560
Plasmid#207444Purpose6xHis-SS-TEV-ErkB-Y178A bacterial expression vectorDepositorInsertErkB
UseUnspecifiedMutationY178AAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIR4 gRNA HIS
Plasmid#182520PurposeExpression vector for gRNA directed against SIR4 ORF.DepositorInsertSIR4 gRNA (SIR4 Budding Yeast)
ExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAF9D94 (pAF10C6)
Plasmid#185848PurposeExpressing artificial trans-repressor in Saccharomyces cerevisiaeDepositorInsertPHAC1>TetR>CYC8>PABF1
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB441
Plasmid#185131PurposeSwi6 full length with L->A mutated in nuclear localization signalDepositorInsertSWI6
TagsGFPExpressionYeastMutationSWI6 deletion of amino acids 450-458Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB553
Plasmid#185107Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with Y180L, Q182LDepositorInsertPOM152
TagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB439
Plasmid#185093PurposeNMA111-GFP wild type under control of GAL1 promoter (complements nma111 deletion)DepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::NMA111-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB345
Plasmid#185078Purposerfa3D46 truncation fused to GFPDepositorInsertRFA3
TagsGFPExpressionYeastMutationRfa3 truncation aa 1-46Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB419
Plasmid#185089PurposeSwi6L-GFP expressing N-term 273 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation at aa 273Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB462
Plasmid#185095PurposeNMA111-GFP with NLS1 and NLS2 mutated under control of GAL1 promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::nma111Dnls1Dnls2-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB466
Plasmid#185099PurposeNMA111-GFP with NLS1 and NLS2 deleted under endogenous promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationNMA111DNLS1DNLS2-GFPAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB354
Plasmid#185082PurposeSwi6L-GFP expressin N-term 273 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation aa 1-273Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB416
Plasmid#185087PurposeSwi6L-GFP with nuclear export signal mutated to alaninesDepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 nuclear export signal L to A mutationsAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB394
Plasmid#185086PurposeNMA111 with both nuclear localization signals mutated to alanines fused to GFP (mutagenesis of KBB280)DepositorInsertNMA111
TagsGFPExpressionYeastMutationNma111 KKR 9-11 AAA; KRK 28-30 AAAAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB349
Plasmid#185080Purposerfa2D248 truncation fused to GFPDepositorInsertRFA2
TagsGFPExpressionYeastMutationRfa2 truncation aa 1-247Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB353
Plasmid#185081PurposeSwi6M-GFP expressing N-term 181 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation aa 1-181Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB484
Plasmid#185132PurposeSWI6-GFP full length under control of GAL1 promotionDepositorInsertSWI6
TagsGFPExpressionYeastAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only