We narrowed to 4,407 results for: crispr c plasmids
-
Plasmid#214033PurposeBacterial expression plasmid for strep-tagged SAVED-CHAT CHAT-CHAT singlet interface mutant from Haliangium ochraceumDepositorInsertSAVED-CHAT
TagsStrep-tag IIExpressionBacterialMutationR456E, D459K, D476K, R479EPromoterT7 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-dPCaspase
Plasmid#214035PurposeBacterial expression plasmid for strep-tagged catalytically dead PCaspase (Prokaryotic Caspase) from Haliangium ochraceumDepositorInsertPCaspase
TagsStrep-tag IIExpressionBacterialMutationH79A, C146APromoterT7 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-PCaspase-R153A
Plasmid#214036PurposeBacterial expression plasmid for strep-tagged PCaspase (Prokaryotic Caspase) R153A mutant from Haliangium ochraceumDepositorInsertPCaspase
TagsStrep-tag IIExpressionBacterialMutationR153APromoterT7 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFTK086
Plasmid#171358PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Arg21]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK063
Plasmid#171335PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK062
Plasmid#171334PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m2) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK057
Plasmid#171329PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4)-VPR-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
(942) pAAV EF1a dCasphi-[myc-ZIM3-HA] U6-gStop
Plasmid#195624PurposepAAV EF1a plasmid for constitutive expression of dCasphi-ZIM3 CRISPRi constructDepositorInsertdCasphi
UseAAVTagsC-Myc (NLS), HA tag, and ZIM3ExpressionMammalianMutationP749A and P753APromoterEF1a (Mlu1/EcoR1)Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain (ADARB1 Synthetic, human gut metagenome, Human)
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available sinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable sinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-en31FnCas9ABEmax8.17d
Plasmid#201956PurposeMammalian expression plasmid of en31FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-en31FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-en15FnCas9
Plasmid#201948PurposeMammalian expression plasmid of enhanced activity FnCas9 variant en15FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-en15FnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationE1603H on FnCas9PromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dSpCas9
Plasmid#201953PurposeMammalian expression plasmid of dead SpCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dSpCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A on SpCas9PromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIG-671_HA-GD2-28z_CAR_tNGFR
Plasmid#207484PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-727_HA-GD2-28z_CAR_RFP-tNGFR
Plasmid#207487PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-tNGFR, HA-GD2-28z_CAR (NGFR Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-747_CD19-28z_CAR_TFAP4
Plasmid#207489PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-28z_CAR (TFAP4 Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-804_HA-GD2-28z_CAR_BATF-TFAP4
Plasmid#207491PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-TFAP4, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-832_NY-ESO-1_TCR_FAS/4-1BB
Plasmid#207495PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/4-1BB, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-836_NY-ESO-1_TCR_FAS/OX40
Plasmid#207499PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/OX40, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-874_HA-GD2-28z_CAR_IL2RA
Plasmid#207504PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertIL2RA, HA-GD2-28z_CAR (IL2RA Human)
UseCRISPRAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-SaKKH-spA-miniU6-miniSdd6-MmHPD-T2
Plasmid#204852PurposeAAV vector for cytosine base editing using miniSdd6 at HPD-T2 target site in mouseDepositorInsertminiSdd6-nSaCas9KKH(D10A)-UGI
UseAAV and CRISPRMutationD10A, E782K, N968K, R1015H in SaCas9PromoterEFS, miniU6Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
1154B_gFLE_pB_VTK_ActG
Plasmid#187238PurposeAn. gambiae transgenesis plasmid. PiggyBac with transposase in backbone. Expresses two gRNAs targeting fleDepositorInsertFemaleless
UseCRISPRExpressionInsectAvailable sinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA15-Ubc-NLS- scFV-tdTomato
Plasmid#199446PurposeExpression of scFV-tdTomato that binds to the GCN4 peptide from the SunTag System in mammalian cellsDepositorInsertscFV-tdTomato
UseLentiviralExpressionMammalianPromoterhuman ubiquitin C (UBC)Available sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19_mRuby-3xFLAG-NLS-3xSV40-poly(A)_loxP-PGK-Puro-loxP
Plasmid#195505PurposeT-REX17 donor plasmid to generate locus specific integration of mRuby followed by 3xSV40 poly(A) into Exon 1 of human lncRNA T-REX17DepositorInsertpT-REX-mRuby-3xFLAG-NLS-3xSV40-poly(A)_loxP-PGK-Puro-loxP_T-REX(Ex1)
UseCRISPR; Donor vectorTagsmRuby-3xFLAG-NLS-3xSV40-poly(A)ExpressionMammalianAvailable sinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ284-RVR
Plasmid#138117PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Mb2Cas12a with N563R, K569V and N573R mutations, without promoterDepositorInsertMb2Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN563R, K569V and N573RAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ284-v2
Plasmid#138119PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Mb2Cas12a with D172R, N563R and K569R mutations, without promoterDepositorInsertMb2Cas12a v2
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationD172R, N563R and K569RAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ233-STU
Plasmid#138111PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized, catalytically deactivated LbCas12a-SRDX repressor without promoter and terminatorDepositorInsertdLbCas12a-SRDX
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only