We narrowed to 4,854 results for: u6
-
Plasmid#90919Purpose3rd generation lentiviral gRNA plasmid targeting human TPX2DepositorInsertTPX2 (Guide Designation H2.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E12.3 gRNA
Plasmid#90645Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E12.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E11.3 gRNA
Plasmid#90644Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E11.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FBXO5 D4.4 gRNA
Plasmid#90687Purpose3rd generation lentiviral gRNA plasmid targeting human FBXO5DepositorInsertFBXO5 (Guide Designation D4.4)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F1.1 gRNA
Plasmid#90744Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F1.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F2.1 gRNA
Plasmid#90745Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F2.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC102
Plasmid#62337PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS1376
Plasmid#239829PurposeWT OrufIscB omegaRNA mammalian expressionDepositorInsertOrufIscB omegaRNA scaffold
UseTagsExpressionMammalianMutationPromoterhuman U6Available sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGK58
Plasmid#228118PurposeExpress node 814 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 814, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRRv2_sgTom
Plasmid#218346PurposeCRISPR KO plasmid for tdTomato in human cell linesDepositorInsertInserted sgRNA targetting tdTomato
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterhuman U6Available sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK65
Plasmid#228123PurposeExpress node 1795 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1550, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK59
Plasmid#228119PurposeExpress node 1429 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1429, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK57
Plasmid#228117PurposeExpress node 482 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 482, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK56
Plasmid#228116PurposeExpress node 412 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 412, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK60
Plasmid#228120PurposeExpress node 1438 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1438, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK55
Plasmid#228114PurposeExpress node 2 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 2, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
UseTagsExpressionMammalianMutationPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only