We narrowed to 2,669 results for: PGK
-
Plasmid#204227PurposeEpisomal yeast plasmid expressing the Ercas12aDepositorInsertEubacterium rectale cas12a (Ercas12a)
ExpressionYeastMutationcodon optimized for S. cerevisiaePromoterSaccharomyces cerevisiae PGK1Available SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V1
Plasmid#222503PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V3
Plasmid#222506PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJM1-blast-TFIIB-Halo
Plasmid#213924PurposeLentivector for expression of TFIIB followed by flexible linker and C-terminal HaloTagDepositorInsertTFIIB-Halo (GTF2B Human)
UseLentiviralExpressionMammalianMutationCoding region changed for resistance to Dharmaco…PromoterCMV/hPGKAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-catΔ
Plasmid#222508PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only