Skip to main content
Addgene

We narrowed to 21 results for: PGK

Showing: 1 - 20 of 21 results
  1. Plasmids 101: Cre-lox

    Type
    Blog Post
    ..., Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to successfully introduce Cre ...
  2. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...interest from the CB promoter pCDH-PGK 72268 xpress gene of interest from the PGK (phosphoglycerate kinase I)...enhancer pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro 73040 Expresses Nluc and copGFP from the PGK promoter Adenoviral...
  3. Cre-lox system

    Type
    Collection
    ...insulin Zebrafish Stainier 24593 AAV-pgk-Cre codon optimized Cre PGK AAV Aebischer 24704 GFAP-Cre Cre GFAP...Tamoxifen inducible PGK Retroviral Lowe 33342 LGmCreER (non-self deleting) Cre-ERT2 PGK Retroviral Lowe 33344...of EGFP; See also similar plasmids pSico PGK GFP and pSico PGK puro Lentiviral Jacks 11579 pSicoR Cre turns...insulator probasin Mammalian Green 11543 pPGK-Cre-bpA Cre PGK Mammalian Rajewsky 11916 pBS185 CMV-Cre ...VCre CAG Mammalian Wong 91789 pRRlsinPGK_CREGFP_WPRE Cre-GFP fusion PGK Lentiviral Torok-Storb 99249 pVAX1...Tyrosinase Mammalian Blank 101242 pSin wPGK-Cre low-efficiency Cre PGK Mammalian Nedivi 102989 pCAG-Cre-T2A-mRuby2...vector Cre, Puro resistance and miRNA expression PGK Lentiviral Jacks 17736 pOG231 NLS-Cre CMV Mammalian...
  4. Luciferase Plasmid Collection

    Type
    Collection
    ...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly ...luciferase Linzhao Cheng 74444 pLenti.PGK.blast-Renilla_Luciferase Renilla PGK Lentiviral expression of Renilla...Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo) Akaluc hPGK Lentiviral expression of Venus-Aka-luciferase...luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc (puro) Firefly hPGK Lentiviral expression of Venus-firefly...firefly luciferase Eric Kowarz 18782 MSCV Luciferase PGK-hygro Firefly SV40 Retroviral expression of firefly...
  5. Recombinases AAV Preps

    Type
    Collection
    ...AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson 24593 AAV-pgk-Cre PGK none rg* Aebischer 51507 AAV pmSyn1-EBFP-Cre ...
  6. Lentivirus Plasmids

    Type
    Collection
    ...pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway...3rd Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puro. See article for more versions of this...
  7. Retrograde AAV viral preps

    Type
    Collection
    ....WPRE.rBG EF1a EGFP Control Wilson 24593 AAV-pgk-Cre PGK Cre expression Recombinases Aebischer 55632 pAAV-Ef1a-mCherry-IRES-Cre...
  8. Retrovirus Plasmids

    Type
    Collection
    ...increases export to the cytoplasm Hahn 11375 MDH1-PGK-GFP_2.0 MSCV Retroviral construct for miRNA expression...
  9. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Plasmids and Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin Mammalian, Varies pLKO...mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1...
  10. Promoters

    Type
    Guide
    ...CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate...
  11. Sequencing Primers

    Type
    Guide
    ...virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG Mouse PGK promoter, forward primer MSCV CCCTTGAACCTCCTCGTTCGACC...
  12. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...10880 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR...Parkinson's Niels Gehring 66818 pCCL-PGK-SPdCas9-BFP-DNMT1 DNMT1 PGK Hereditary sensory neuropathy type ...Lippincott-Schwartz 164214 PLEX-PGK-ANXA11-mCerulean ANXA11 mCerulean PGK ALS Jennifer Lippincott-Schwartz... Parkinson's, FTD Mark Mayford 35000 Nurr1 NR4A2 PGK Parkinson's Malin Parmar 35217 psen2_L (OZ577) PSEN2...Trimmer 129409 Slc1a3-CreERT2 Targeting Vector SLC1A3 PGK Episodic ataxia Walker Jackson 129410 px335 Slc1a3...
  13. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...59936 Worm BsaI none S. pyogenes Fire pGL3-U6-sgRNA-PGK-Puro 51133 Mammalian none S. pyogenes Puro Huang ...cut S. pyogenes Puro Zhang pKLV-U6gRNA(BbsI)-PGKpuro2ABFP 50946 Mammalian/Lentiviral BbsI none S. pyogenes... S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI none S. pyogenes...
Showing: 1 - 20 of 21 results