We narrowed to 46,632 results for: cha;
-
Plasmid#139775PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter HA tag under the pH promoter.DepositorInsertC-terminal Hemaglutinine tag
TagsHAPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-6His-Cter (VE5630)
Plasmid#139777PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter6His tag under the pH promoter.DepositorInsertC-terminal 6His tag
Tags6 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-c-Myc-Cter (VE5632)
Plasmid#139778PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter C-Myc tag under the pH promoter.DepositorInsertC-terminal C-Myc tag
Tagsc-MycExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-3C-10His-Cter (VE5622)
Plasmid#139771PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter 10-His tag under the pH promoter.DepositorInsertC-terminal 10-His tag
Tags3C - 10HisPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 (1-645, Δ368-523)/pcDNA3.1
Plasmid#111456PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
ExpressionMammalianMutationKv7.4 (1-645, Δ368-523), C643AAvailable SinceMay 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR3c-K717M
Plasmid#45715DepositorAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDGa.1
Plasmid#81049Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
TagsGSTExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only