We narrowed to 13,013 results for: HAL
-
Plasmid#129204PurposeyTRAP sensor of [RNQ+], detects aggregation of Rnq1DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pNH13 (pmyo-2::QuasAr::mOrange)
Plasmid#130273PurposeExpresses the eFRET-based voltage sensor QuasAr::mOrange in the pharynx of C. elegans.DepositorInsertQuasAr::mOrange
TagsmOrangeExpressionWormAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN200
Plasmid#129203PurposeyTRAP sensor of [PSI+], detects aggregation of Sup35DepositorInsertSup35NM (SUP35 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationN terminal and middle domainsPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK267
Plasmid#129272Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed proteinDepositorInsertNLS-VP16-ZF 43-8-NES
Tags6xHAExpressionYeastPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
HSPD1-i7 -HT2
Plasmid#236333PurposeInducibly expresses HSPD1 tagged with HaloTag2 at the relative location of intron 7 in the HSPD1 gene.DepositorAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
CALR-i2-HT2
Plasmid#236334PurposeInducibly expresses CALR tagged with HaloTag2 at the relative location of intron 2 in the CALR gene.DepositorInsertCALR (CALR Human)
UseLentiviralTagsHaloTag2 internal insertion at intron 2ExpressionMammalianAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
EPHA2-i16-HT2
Plasmid#236335PurposeInducibly expresses EPHA2 tagged with HaloTag2 at the relative location of intron 16 in the EPHA2 gene.DepositorInsertEPHA2 (EPHA2 Human)
UseLentiviralTagsHaloTag2 internal insertion at intron 16ExpressionMammalianAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only