We narrowed to 10,767 results for: yeast
-
Plasmid#29371DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationWild type gene including genomic sequence 1432 bp…Available sinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAV10.KN
Plasmid#63209PurposepCACS backbone (Amp), cloNAT, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. Integration into YKL162C-A (NotI).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
YIplac204-pOst1-ESCargo(Crimson)
Plasmid#140154PurposeExpresses a vacuolar cargo for yeast at the TRP1 locusDepositorInsertpOst1-APVNTT-DsRed-Express2-FKBP(FV)C22V-QRPL
ExpressionYeastPromoterTPI1Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYTK073
Plasmid#65180PurposeEncodes ConRE' as a Type 5 part to be used in the Dueber YTK systemDepositorPublicationInsertConRE'
ExpressionBacterialAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK076
Plasmid#65183PurposeEncodes HIS3 as a Type 6 part to be used in the Dueber YTK systemDepositorPublicationInsertHIS3
ExpressionBacterialAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK079
Plasmid#65186PurposeEncodes HygromycinR as a Type 6 part to be used in the Dueber YTK systemDepositorPublicationInsertHygromycinR
ExpressionBacterialAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYTK085
Plasmid#65192PurposeEncodes SpecR-ColE1 as a Type 8 part to be used in the Dueber YTK systemDepositorPublicationInsertSpecR-ColE1
ExpressionBacterialAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYTK091
Plasmid#65198PurposeEncodes SpecR-ColE1 as a Type 8a part to be used in the Dueber YTK systemDepositorPublicationInsertSpecR-ColE1
ExpressionBacterialAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pFA6a-mIAA7-mCherry-HIS3MX6
Plasmid#247624PurposeYeast gene tagging with mIAA7DepositorInsertmIAA7
TagsmCherryExpressionYeastAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-mIAA7-mNeon-hphNT1
Plasmid#247631PurposeYeast gene tagging with mIAA7DepositorInsertmIAA7
TagsmNeonGreenExpressionYeastAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-mAID-mNeon-kITRP1
Plasmid#247602PurposeYeast gene tagging with mAIDDepositorInsertmAID
TagsmNeonGreenExpressionYeastAvailable sinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-mAID-mNeon-HIS3MX6
Plasmid#247601PurposeYeast gene tagging with mAIDDepositorInsertmAID
TagsmNeonGreenExpressionYeastAvailable sinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BioID2-HA3-KanMX6
Plasmid#227976PurposeTo insert HA-tagged biotin ligase, BioID2, at the C-terminus of genes; yeast BioID, KanMX6 markerDepositorInsertBioID2
TagsHA tagExpressionYeastAvailable sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BirA-HA3-KanMX6
Plasmid#227974PurposeTo insert HA-tagged biotin ligase, BirA, at the C-terminus of genes; yeast BioID with KanMX6 markerDepositorInsertBirA
TagsHA tagExpressionYeastAvailable sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymStayGold-T2A-mCherry
Plasmid#219843Purposeequimolar expression of ymStayGold and mCherry in budding yeastDepositorInsertymStayGold-T2A-mCherry
ExpressionYeastAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only