We narrowed to 10,180 results for: yeast
-
Plasmid#29391DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationR62A mutant gene including genomic sequence 1432 …Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH356-SUP45-T295A
Plasmid#29389DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationT295A mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH393-SUP45-T357A
Plasmid#29392DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationT357A mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH357-SUP45-T388A
Plasmid#29393DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationT388A mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH363-SUP45-F401Y
Plasmid#29394DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationF401Y mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH364-SUP45-Y410F
Plasmid#29395DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationY410F mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
-
pC1-CMV-mito-DAAO
Plasmid#141132PurposeExpresses DAAO with mitochondrial localization signal in mammalian cellsDepositorInsertmito-DAAO
Tags2 mitochondrial localization signals and 7xHisExpressionMammalianMutationdeleted DAAO amino acids 367-368PromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pMN234
Plasmid#32108DepositorInsertflpe
ExpressionBacterialPromoterimycAvailable SinceNov. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS415-IVa
Plasmid#31460DepositorInsertlinker
ExpressionWormAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HHtRNA
Plasmid#37222DepositorInsertHHtRNA
ExpressionBacterialAvailable SinceJuly 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS414-7x2-PHO5-GFP-hPLC delta PH domain dimer
Plasmid#58837PurposeExpresses GFP-Tagged Human PLC delta PH domain in yeastDepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGustiv
Plasmid#240335PurposeExpresses BK polyomavirus genotype IV capsid protein VP1 in yeast. Expression of VP1 (and a GFP reporter) is induced by maltose.DepositorInsertsBKV-IV VP1
Superfold GFP
Formaldehyde dehydrogenase 1
ExpressionYeastPromoterFDH1, MAL31, and MAL32Available SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_TDH3
Plasmid#166084PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of TDH3 for double stranded break formation in yeast.DepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTYB2-eIF1A
Plasmid#37218DepositorInserteIF1A
ExpressionBacterialPromoterT7Available SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJH2971
Plasmid#100955PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. KANMX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH2972
Plasmid#100956PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. URA3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJH2970
Plasmid#100954PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HIS3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMN252
Plasmid#32177DepositorInsertrpsL, FRT-hyg-FRT
ExpressionBacterialAvailable SinceNov. 21, 2011AvailabilityAcademic Institutions and Nonprofits only