We narrowed to 2,753 results for: SAB
-
Plasmid#212323PurposeEGFP-tagged IARS1 Trp435CysDepositorAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLJM1-FH-AGO2-5xA
Plasmid#91979PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
UseLentiviralTagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-5xE
Plasmid#91981PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
UseLentiviralTagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-hMICU1EF
Plasmid#199180PurposeThis plasmid is used to express a EF-hand disabled human MICU1 protein in E. coli. The protein is fused with a maltose binding protein in the N-terminus, and also contains a C-terminal His6 tag.DepositorInsertMICU1 (MICU1 Human)
TagsHis6 and MBP, Thrombin site, TEV siteMutationD421A, E432K, F433W, F453WAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA
Plasmid#160141PurposeCre- dependent expression of Sun1GFP for nuclei isolationDepositorInsertSun1-GFP (Sun1 Mouse)
UseAAVTagsGFPExpressionMammalianMutationN-truncated: removed amino acids 1-207, retained …PromoterEf1aAvailable SinceMarch 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1428
Plasmid#29224PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1091
Plasmid#29025PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748) and de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1092
Plasmid#29026PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1427
Plasmid#29223PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only