We narrowed to 3,475 results for: biorxiv
-
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
SRGAP2C_pEF-DEST51
Plasmid#238497PurposeIVT mRNA of human geneDepositorInsertSRGAP2C (SRGAP2C Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARHGAP11B_pEF-DEST51
Plasmid#238498PurposeIVT mRNA of human geneDepositorInsertARHGAP11B (ARHGAP11B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GPR89B_full_pGCS1
Plasmid#238499PurposeIVT mRNA of human geneDepositorInsertGPR89B (GPR89B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED solvvol
Plasmid#232958PurposeGalactose iduced expression of Gcn4 LVtoED solvvol in yeastDepositorInsertGcn4 ILVtoED solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED solvvol
Plasmid#231858PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED solvvolDepositorInsertGcn4 ILVtoED solvvol
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterT7Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMEM16A-I547K-peGFP-N1
Plasmid#228583PurposeExpresses mouse TMEM16A-I547K-eGFP in mammalian cellsDepositorInsertTMEM16A/anoctamin 1 (Ano1), transcript variant 2 (Ano1 Mouse)
ExpressionMammalianMutationI547KAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM16A-E551K-peGFP-N1
Plasmid#228584PurposeExpresses mouse TMEM16A-E551K-eGFP in mammalian cellsDepositorInsertTMEM16A/anoctamin 1 (Ano1), transcript variant 2 (Ano1 Mouse)
ExpressionMammalianMutationE551KAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideB3GNT5-neo
Plasmid#220867Purposeencodes CRISPR sgRNA targeting human B3GNT5DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pITESceIcmd
Plasmid#218288PurposeIntroduction of a cyanamide-inducible I-SceI expression cassette, use in combination with pITEdv1DepositorInsertHO(-253, -1)-tSynth3ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-GST-TEV-NAP1
Plasmid#217610PurposeFor expression in E. coli of NAP1DepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-GST-TEV-GFP-NAP1
Plasmid#208870PurposeFor expression in E. coli of GFP-NAP1DepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only