We narrowed to 44,548 results for: INA
-
Plasmid#139776PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the pH promoter.DepositorInsertC-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-Flag-Cter(VE5738)
Plasmid#161798PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the p10 promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterp10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-10His-Nter-GWs-Lox (VE5588)
Plasmid#161806PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 10 His tag under the pH promoter.DepositorInsertN-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st WW mutant
Plasmid#18998DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-2nd WW mutant
Plasmid#18999DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 258 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 N539
Plasmid#25972DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
TagsFlagExpressionMammalianMutationDeleted amino acids 540-873Available SinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 C540
Plasmid#25971DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
TagsFlagExpressionMammalianMutationDeletes amino acids 1-539Available SinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Yes-SH2-AviTag
Plasmid#214208PurposeBacterial expression of SH2 domain of the Yes kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertYes kinase SH2 domain (YES1 Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-ExRai-AKAR2-T/A
Plasmid#171847PurposeCre-dependent, synapsin promoter-driven expression of the negative control phosphomutant ExRai-AKAR2 T/A PKA biosensor in neurons.DepositorInsertExRai-AKAR2 T/A
UseAAVExpressionMammalianMutationT6A phospho-deficient mutationPromoterhSyn1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-NEDD4L_FL-CS
Plasmid#187713PurposeExpress the catalytically inactive GST-tagged NEDD4L FL in bacterial cellsDepositorInsertNEDD4L FL with C874 mutated to a serine (NEDD4L Human)
TagsGST-HRV 3C siteExpressionBacterialMutationCys874 mutated to a serineAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22iU66CriT(#387)
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral N
Plasmid#113009PurposeFor bacterial expression of MBP fusion of N terminal region of Drosophila TralDepositorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-superDn29-dCas9-P2A-GFP
Plasmid#247156PurposeMammalian expression of a human codon optimized engineered superDn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertsuperDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationM6I/E70G/A224P/G227V/I233K/K248R/I303K/Q332K/N341…PromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-NLRP3
Plasmid#75127PurposeExpresses N-terminal Flag-tagged NLRP3 in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (Nlrp3 Mouse)
TagsFlagExpressionMammalianPromoterCMVAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only