We narrowed to 12,031 results for: CHL
-
Plasmid#61943PurposeCo-expression of hUCH37 (ISF1) and hNFRKB (39-156) in E.coliDepositorInsertsTags6x HISExpressionBacterialMutationResidues 2-39 deleted resulting in construct star…PromoterT7Available SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pSR77
Plasmid#251524PurposeExpresses Type IV-A1 Cas5,6,7,8, Repeat-Spacer-Repeat CRISPR-RNA, CasDinG from Pseudomonas oleovoransDepositorInsertsCas6
Cas8
Cas7
Cas5
CRISPR-RNA
CasDinG
ExpressionBacterialPromoterT7Available SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)_His10x-TEV-Rho-tag
Plasmid#249665PurposeExpression of rhodamine-binding protein tag in bacterial cellsDepositorInsertRho-tag
ExpressionBacterialAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)_His10x-TEV-SiR-tag
Plasmid#249666PurposeExpression of silicon rhodamine-binding protein tag in bacterial cellsDepositorInsertSiR-tag
ExpressionBacterialAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNoRBP.iGlucoSnFR2.mIRFP670nano3
Plasmid#244107PurposeBacterial expression of green glucose sensor with inert mIRFP670nano3DepositorInsertiGlucoSnFR2.mIRFP670nano3
TagsmIRFP670nano3ExpressionBacterialAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(ER).iGlucoSnFR2.HaloTag
Plasmid#244076PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNoRBP.iGlucoSnFR2.H348H.HaloTag
Plasmid#244108PurposeBacterial expression of green glucose sensor (high affinity) with inert HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
TagsHaloTagExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G33650-mKOk
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL562
Plasmid#231162PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlCHL1DepositorInsertmobile gRNA targeting SlCHL1
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PtetA-PBAD-PLacO3O1 200bp with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225649PurposetetA, araBAD and LacO3O1 promoters in tandem conformation with 200bp distance between them, expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA, araBAD and LacO3O1 in tandem conformation
TagsmCherryExpressionBacterialPromotertetA, araBAD and LacO3O1 promotersAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB143
Plasmid#222214PurposeFor recombinant expression of vanB (PP_3737 from Pseudomonas putida) with the A24P mutation and an N-terminal thrombin-cleavable His tagDepositorInsertvanB(A24P)
TagsN-terminal, thrombin-cleavable 6x His tagExpressionBacterialMutationChanged Alanine 24 to ProlinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSN95
Plasmid#222220PurposeFor recombinant expression of vanA (PP_3736 from Pseudomonas putida) with a C-terminal His tagDepositorInsertvanA putida (PP_RS19450 Pseudomonas putida KT2440)
Tags6x HisExpressionBacterialPromoterT5-lacAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB109
Plasmid#222208PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the K10N mutation and a C-terminal His tagDepositorInsertfghA (K10N)
Tags6x HisExpressionBacterialMutationChanged Lys10 to AsnPromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB110
Plasmid#222209PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G258D mutation and a C-terminal His tagDepositorInsertfghA (G258D)
Tags6x HisExpressionBacterialMutationChanged Gly258 to AspartatePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB111
Plasmid#222210PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G76V mutation and a C-terminal His tagDepositorInsertfghA(G76V)
Tags6x HisExpressionBacterialMutationChanged glycine 76 to valinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB112
Plasmid#222211PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the S11R mutation and a C-terminal His tagDepositorInsertfghA(S11R)
Tags6x HisExpressionBacterialMutationChanged Serine 11 to ArgininePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB113
Plasmid#222212PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the W15C mutation and a C-terminal His tagDepositorInsertfghA(W15C)
Tags6x HisExpressionBacterialMutationChanged Tryptophan 15 to CysteinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
Plasmid#217514PurposeEncodes a UAS controlled and Flp dependent conditional trangene of bicistronic myrTdtomato and KD RecombinaseDepositorInsert10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
ExpressionInsectAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only