We narrowed to 1,764 results for: plasmid for e coli
-
Plasmid#222330PurposeFluorescent reporter plasmid for VeillonellaDepositorInsertbs2 gene with Veillonella parvula SKV38 mdh promoter
UseE. coli-veillonella shuttle plasmidExpressionBacterialPromoterVeillonella parvula SKV38 mdh promoterAvailable SinceOct. 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlk_N + pSiMPlk_C
Plasmid#134310PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertkanR_gp41-1 N-intein + kanR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPla_N + pSiMPla_C
Plasmid#134314PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertampR_gp41-1 N-intein + ampR_gp41-1 C-intein
ExpressionBacterialAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlh_N + pSiMPlh_C
Plasmid#134316PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInserthygR_gp41-1 N-intein + hygR_gp41-1 C-intein
ExpressionBacterialMutationP254Q in hygR_gp41-1 N-inteinAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIMAY
Plasmid#68939PurposeE. coli/staphylococcal temperature-sensitive plasmid for allelic exchangeDepositorTypeEmpty backboneUseStaphylococcal allelic exchange vectorAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Yellow
Plasmid#160443PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Yellow chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Yellow
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only