We narrowed to 8,860 results for: sgRNA
-
Plasmid#76356Purpose3rd generation lentiviral gRNA plasmid targeting human PHKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PFKFB4 gRNA (BRDN0001149495)
Plasmid#77123Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB4DepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001487049)
Plasmid#77981Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001162440)
Plasmid#76140Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
STK17A gRNA (BRDN0001149480)
Plasmid#77916Purpose3rd generation lentiviral gRNA plasmid targeting human STK17ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17B gRNA (BRDN0001146764)
Plasmid#76798Purpose3rd generation lentiviral gRNA plasmid targeting human STK17BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146792)
Plasmid#77948Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146747)
Plasmid#77949Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001487150)
Plasmid#77950Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001146969)
Plasmid#77982Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147151)
Plasmid#76461Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147212)
Plasmid#76463Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001144909)
Plasmid#76890Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAA1 gRNA (BRDN0001146526)
Plasmid#76253Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only