We narrowed to 2,981 results for: erf
-
Plasmid#148513PurposeBacterial Expression of DmeIF4Ga_617-630-DmThor_64-83DepositorInsertDmeIF4Ga_617-630-DmThor_64-83 (eIF4G1 Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-CD55
Plasmid#153959PurposeUsed for EGxxFP assay with CD55 intron 3, exon 4, and intron 4 sequencesDepositorInsertCD55 (a 1,016-bp fragment from intron 3, exon 4, and intron 4)
UseA plasmid specific for egxxfp assayTagsN/AExpressionMammalianMutationNo mutationPromoterCAG promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-AP-His
Plasmid#71956PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Kek1 (Lip1) clone #1
Plasmid#38750DepositorInsertKek1 (kek1 Fly)
Available SinceSept. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
IFI16-(192-393)-HinA-E222A-E272A-E381A
Plasmid#35061DepositorInsertIFI16-(192-393)-HinA (IFI16 Human)
TagsHisMutationContains HinA domain: aa 192-393; E222A, E272A, a…PromoterT7Available SinceApril 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pKb-POC1-ABE8e
Plasmid#255130PurposePlant expression of TadA8e-OpenCRISPR1 D10A for adenine base editing.DepositorInsertTadA8e fused at 5' of the Rice codon optimized pOC1 D10A
TagsNAExpressionPlantPromoterMaize ubiquitin promoter for TadA8e-OpenCRISPR1 D…Available SinceJuly 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spIgE-3xFLAG-DR18 IRES mNeonGreen-P2A-Puro
Plasmid#248038PurposeConstitutively expresses 3xFLAG tagged DR18 with an IgE signal peptide, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged DR18
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spnull-3xFLAG-DR18 IRES mNeonGreen-P2A-Puro
Plasmid#248037PurposeConstitutively expresses 3xFLAG tagged DR18, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged DR18
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spnull-3xFLAG-Neo2/15 IRES mNeonGreen-P2A-Puro
Plasmid#248033PurposeConstitutively expresses 3xFLAG tagged Neoleukin 2/15, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged Neoleukin-2/15
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G33650-mKOk
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMDA5_2g)-PGKpuro2AmCherry-W
Plasmid#208436PurposeLentiviral gRNA plasmid targeting human MDA5 gene, co-expression of mCherry tagDepositorInsertMDA5 (IFIH1 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U10Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_WT-VA
Plasmid#191221PurposeLentiviral expression of human IFIT5_WT in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianPromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
prCOrev
Plasmid#153961PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the opposite direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCO
Plasmid#153960PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the same direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only