We narrowed to 10,492 results for: nar;
-
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
UseTagsc-mycExpressionMammalianMutationPromoterCAGAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
IR904: pMVP (L3-L2) pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121799PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
UseTagsRenSP (optimized renilla luciferase gene)ExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTE4567
Plasmid#107557PurposeExpresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.DepositorInserthMbCpf1(dead2)
UseTags3xHA and NLSExpressionMammalianMutationE1080APromoterCMVAvailable sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B2UP49_GFP
Plasmid#103071PurposeCas9 coding gene template with optimized sequence for human codon usage, also expresses EGFPDepositorInsertB2UP49(Cas9 coding gene from Akkermansia muciniphila (strain ATCC BAA-835))
UseCRISPRTagsExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A0LWB3
Plasmid#103070PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA0LWB3(Cas9 coding gene from Acidothermus cellulolyticus (strain ATCC 43068 / 11B))
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-K1LM04
Plasmid#103119PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertK1LM04(Cas9 coding gene from Bergeyella zoohelcum ATCC 43767)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
KN801: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-VPR
Plasmid#121829PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO001: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-p300core
Plasmid#121832PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMCh2007_pLenti_Syn_mChe-cdc42E7
Plasmid#118620Purposeexpression of mChe-tagged cdc42E7 under pSyn promoter for primary neuronsDepositorInsertcdc42E7 (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged cagtctg to ggcataa (667 - 673 nt in 3…Promotersynapsin I (rat)Available sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
API5-CRISPR
Plasmid#157664PurposeExpresses Cas9 and sgRNA targeting API5DepositorInsertApoptosis inhibitor 5 (API5 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6I4Q5
Plasmid#103101PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6I4Q5(Cas9 coding gene from Enterococcus faecalis TX0012)
UseCRISPR; Cloning vectorTagsExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
KB601: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121819PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SlutrCas9
Plasmid#163795PurposeExpresses SlutrCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
ShaCas9
Plasmid#163794PurposeExpresses ShaCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD406
Plasmid#163111PurposeExpression of mNeonGreen_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mNeonGreen_H-NSdbd_NLS
UseEukaryotic expressionTagsExpressionMammalianMutationPromoterCMV promoter; T7 promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD399
Plasmid#163106PurposeExpression of mEGFP_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mEGFP_H-NSdbd_NLS
UseEukaryotic expressionTagsExpressionMammalianMutationPromoterCMV promoter; T7 promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only