We narrowed to 26,934 results for: gfp gene
-
Plasmid#246912PurposeLentiviral-based expression of EGFP with an ER retention signal sequence in mammalian cellsDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBE-Cas12a-GFP
Plasmid#246533PurposePlant co-editing vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterCmYLCVAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(ylt1)
Plasmid#246662PurposeMammalian expression of mutant, eGFP tagged DNAJC13DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationMutated 2206-Y 2207-L 2208-T to AlaninesPromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(hpd)
Plasmid#246663PurposeMammalian expression of DnaJ domain mutant, eGFP tagged DNAJC13DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationMutated 1332-H, 1333-P, 1334-D to AlaninesPromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(2198t)
Plasmid#246661PurposeMammalian expression of truncated, eGFP tagged DNAJC13DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationDeletion of residues 2199 to 2243 (c-terminal res…PromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(351t)
Plasmid#246666PurposeMammalian expression of truncated, eGFP tagged DNAJC13 (PH-like domain only)DepositorInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianMutationDeletion of residues 352 to 2243PromoterCMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-Serbp1-meGFP
Plasmid#241316Purposemouse Serbp1 fused to meGFP for expression in mammalian cellsDepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRPML1 Y499A-EGFP
Plasmid#245040PurposeExpresses TRPML1 mutant with C-terminus EGFP tag in mammalian cellsDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
CDKL5(isoform1)-GFP
Plasmid#245903PurposeMammalian expression of CDKL5 isoform1 (1-960) with C-terminal GFPDepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMBD2-1-GFP pc2067
Plasmid#229559PurposeMammalian expression vector codes for MBD2(aa 1-152) fused c-terminal to GFP.DepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2.2-GFP pc2068
Plasmid#229560PurposeMammalian expression vector codes for MBD2(aa 153-414) fused c-terminal to GFP.DepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1-2A-sfGFP
Plasmid#240098Purposehuman PAX3::FOXO1 in -2A-sfGFP backbone (Plasmid# 74668)DepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-GFP
Plasmid#243759PurposeAAV plasmid expressing GFP under the CAG promoter.DepositorInsertEnhanced Green Fluorescent Protein
UseAAVPromoterCAGAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.SynFLEX.(cyto).cpSFGFP.mIRFP670nano3
Plasmid#244918PurposecpSFGFP control with non-responsive mIRFP670nano3DepositorInsertcpSFGFP.mIRFP670nano3
UseAAVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mEGFP-Rab7a
Plasmid#246263PurposeRab7 sensor donorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mEGFP-Rab10
Plasmid#246281PurposeRab10 sensor donorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAAGS-mEGFP-Rab5a
Plasmid#246259PurposeRab5 sensor donorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mEGFP-Rab4a
Plasmid#246250PurposeRab4 sensor donorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_7-8_006_Kan/ColEI_sfGFP
Plasmid#235972PurposeKanamycin/ColEI backbone with sfGFP placeholder for lvl2 assemblyDepositorInsertKan/ColEI
UseSynthetic BiologyAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1α-eGFP
Plasmid#179924PurposeC terminal fusion of EGFP to mouse HP1α (Cbx5)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1β-eGFP
Plasmid#179925PurposeC terminal fusion of EGFP to mouse HP1β (Cbx1)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1γ-EGFP
Plasmid#179926PurposeC terminal fusion of EGFP to mouse HP1γ (Cbx3)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a F59S
Plasmid#245020PurposeEffector binding rat Rab3a F59S mutantDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a IDF/A3
Plasmid#245016PurposeEffector binding mutant of rat Rab3aDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Rab3 GAP1
Plasmid#245050PurposeDistribution and localization of human wild-type GAP1 in cellsDepositorInsertGAP1
TagsGFPExpressionMammalianAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a T36N
Plasmid#245014PurposeDistribution and localization of rat Rab3a T36N mutantDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shAtg7-EGFP
Plasmid#227684PurposeExpresses EGFP and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Bach2_P2A_EGFP
Plasmid#242200PurposeExpresses Bach2 with GFP in mammalian cells.DepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2_Ubi_N41 CNBD AcGFP
Plasmid#241360PurposepMPS37; ubiquitously expresses cAMP sensor; zebrafish transgeneDepositorInsertUbi:CNBD-AcGFP
UseTol2 zebrafish transgene expression; gatewayTagsAcGFPAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β1β6-EGFP
Plasmid#242826PurposeEncodes human integrin β1 chimera containing integrin β6 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 1, transcript variant 1A (ITGB1 Human)
ExpressionMammalianMutationIntegrin β1 chimera containing the cytoplasmic ta…Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2_Ubi_N41_R307Q CNBD AcGFP
Plasmid#241361PurposepMPS55; ubiquitously expresses cAMP sensor(cAMP-insensitive mutant control); zebrafish transgeneDepositorInsertUbi:CNBD_R307Q-AcGFP
UseTol2 zebrafish transgene expression; gatewayTagsAcGFPAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MBP-GFP-RGG
Plasmid#242453PurposeExpresses the MBP-GFP-RGG fusion protein.DepositorInsertMBP-GFP-RGG
TagsHis and MBPExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GST-GFP-RGG
Plasmid#242454PurposeExpresses the GST-GFP-RGG fusion protein.DepositorInsertGST-GFP-RGG
TagsGST and HisExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β6β1-EGFP
Plasmid#242829PurposeEncodes human integrin β6 chimera containing integrin β1 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 6, transcript variant 1 (ITGB6 Human)
ExpressionMammalianMutationIntegrin β6 chimera containing the cytoplasmic ta…Available SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
phSyn2 sfGFP-RNF152
Plasmid#215374PurposeLentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter.DepositorInsertRNF152 (RNF152 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_T11_EGFP-Responder
Plasmid#230051PurposeIt presents the T11 inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertT11_EGFP
ExpressionMammalianAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_TRE3VG_EGFP-Responder
Plasmid#230050PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertTRE3VG_EGFP
ExpressionMammalianPromoterGAAGACAATAGCAGGCATGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1-Pls2-sfGFP
Plasmid#205749PurposeExpresses sfGFP under IPTG inducible promoter Pls2 in high copy pTRKH2 gram-positive shuttle vector. Used in Lactobacillus gasseri. Medium/low strength.DepositorTypeEmpty backboneUseShuttle vector gram+ gram-ExpressionBacterialPromoterPls2 (Phyperspank mutant, IPTG inducible)Available SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-GFP
Plasmid#240128PurposeExpresses GFP in mammalian cellsDepositorInsertGFP
UseRetroviralExpressionMammalianAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-HITI-GFP-Ckm
Plasmid#226119PurposeHITI insert construct with Ckm gRNA and GFP transgeneDepositorAvailable SinceAug. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMT-sfGFP-TurboID-ER
Plasmid#240230PurposeExpression of ER-localized sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBIP-sfGFP-TurboID-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-sfGFP-TurboID-ER
Plasmid#240232PurposeExpression of ER-localized sfGFP-TurboID under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorInsertBIP-sfGFP-TurboID-KDEL
ExpressionInsectPromoterUASAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-CG6867-sfGFP
Plasmid#240237PurposeExpression of CG6867-sfGFP under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10-BioID
Plasmid#145137PurposeExpresses EGFP-MYO10-BioID construct in mammalian cellsDepositorInsertMYO10-BioID (MYO10 Human)
ExpressionMammalianAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only