We narrowed to 11,210 results for: nar;
-
Plasmid#200254PurposeThis plasmid expresses the Cas9-CtIP-dnRNF168 in mammalian cellsDepositorInsertCas9-CtIP-dnRNF168
ExpressionMammalianPromoterCMVAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRL_GI_PCB28
Plasmid#98745PurposeFor phycocyanobilin production in Saccharomyces cerevisiae. Contains integrative cassette for the yeast his1-Δ200 locus. Encodes constitutively expressed HY1 and PcyA.DepositorInsertsUseSynthetic BiologyExpressionYeastMutationCodon optimized for Saccharomyces cerevisiaePromoterADH1m and PGK1Available SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA7-SacB
Plasmid#79968PurposeTM-MAGE strainDepositorInsertsLambda Red recombinase beta subunit
DNA adenine methylase
Levansucrase
UseSynthetic BiologyExpressionBacterialPromoterpBADAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro
Plasmid#171991PurposeDelivers all prime editing nickase components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMH-SFB-DYRK1A
Plasmid#101770PurposeMammalian expression of DYRK1A fusion proteinDepositorInsertDYRK1A (DYRK1A Human)
TagsS peptide-flag-streptavidin binding peptide (SFB)ExpressionMammalianMutationsiRNA-resistant alleleAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1 Clover-LMNA Donor
Plasmid#122508PurposeHomology repair template for in frame (first exon) clover knock-in of human LMNA geneDepositorInsertHomology Repair Template for Human LMNA (N-Terminal Clover Tag) (LMNA Human)
UseHomology repair template plasmid (donor plasmid)TagsCloverAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-WT-NLS-mCherry
Plasmid#60365PurposePlasmid for expression of bacterial RNase HI tagged with NLS-mCherry that can be used to degrade R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI
TagsNLS from SV40 T antigen and mCherryExpressionMammalianPromoterCMV-tetAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot7-D40AE42A_L
Plasmid#146890PurposeMammalian Expression of HsNot7-D40AE42A. Please note that this plasmid does not contain the T7 promoter.DepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 N-T2A-M-IRES-E
Plasmid#231903PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '3-plasmid' systemDepositorExpressionMammalianMutationR203M in N proteinPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
WN10150
Plasmid#80443PurposeExpresses dead (908A) AsCpf1DepositorInsertnuclease dead (908A) AsCpf1
TagsNLS-3xHAExpressionMammalianMutationnuclease dead (D908A)Available SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hCdt1-HA
Plasmid#117500PurposeExpresses human Cdt1 fused to HA tagDepositorInsertCdc10-dependent transcript-1 (CDT1 Human, 1700 bp)
TagsHAExpressionMammalianMutationwild-typePromoterCMVAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Cell-cycle
Plasmid#206280PurposeExpression of a FUCCI cell cycle sensor with a H2B iRFP713 chromatin reporter. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B iRFP713, mAG-hGeminin, mKO2-hCdt1
UseRecombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only