We narrowed to 7,771 results for: aav
-
Plasmid#182202PurposeAdeno-associated viral vector to express histone2B-HaloTag-GFP fusion, a nuclear-localized Halotag-GFP fusion constructDepositorInserthistone2B-HaloTag-GFP
UseAAVAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBK1312-AAV-EFSNC-dSaCas9-KRAB
Plasmid#223157PurposeExpression of KRAB with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB
UseAAV and CRISPRTags3xFLAGExpressionMammalianPromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(PyOtR)-mCherry
Plasmid#204870PurposeExpresses pyrrolysyl tRNA variant "PyOtR" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "PyOtR"
UseAAVExpressionMammalianMutationU25C; A3G, A4C, A5G, C6G, G63C, T65G, T66CPromoterU6Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/5'USS-GFP
Plasmid#197884PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE
Plasmid#183519PurposeOptogeneticsDepositorHas ServiceAAV8InsertChRmine-oScarlet-Kv2.1
UseAAVPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-L-mRuby-Pro-EGFR-mEGFP-4×18
Plasmid#218266PurposeExpresses EGFR-mEGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-EGFR-mEGFP-MREL_4×18
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 bPAC cMyc T2A tDimer
Plasmid#85397Purposehumanized photoactivated adenylyl cyclase with cMyc Tag driven by neuron-specific promoter, plus red fluorescent proteinDepositorInsertshumanized photoactivated adenylyl cyclase
red fluorescent protein
UseAAVTagscMyc TagExpressionMammalianPromoterhuman synapsin-1 and ribosomal skip sequence T2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_eCBmut
Plasmid#164605PurposeExpress the endocannabinoid non-responsive sensor GRAB_eCBmut in neuronsDepositorInsertEndocannabinoid non-responsive sensor GRAB_eCBmut
UseAAVMutationS383T, F177APromoterhSynAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
YA1532: pAAV_ CAG-FLEX-paQuasAr3
Plasmid#107702Purposein vivo voltage imagingDepositorInsertpaQuasAr3
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_SST1.0
Plasmid#208665PurposeExpresses the genetically-encoded fluorescent somatostatin (SST) sensor GRAB_SST1.0 in neuronsDepositorInsertGPCR activation based somatostatin (SST) sensor GRAB_SST1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.iGluSnFR3.v857.SGZ
Plasmid#178337PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV GFAP iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKIIa_SERT_mCherry
Plasmid#198736PurposeSerotonin transporter with mCherry fluorescent protein driven by CaMKIIa promoter on a AAV vectorDepositorInsertSerotonin transporter and mCherry
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-ClopHensorN-WPRE-HGHpA
Plasmid#193728PurposeCre-activated AAV expression of ClopHensorN for measuring intracellular chloride and pH in genetically-defined cell typesDepositorInsertClopHensorN
UseAAVTagsStrep-II (N terminal on insert)ExpressionMammalianPromoterEF1aAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only