We narrowed to 44,705 results for: cha;
-
Plasmid#99619PurposeTo clone gene of interest downstream of FRT1-Mb2YFP-2A cassetteDepositorInsertMb2EYFP
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT2-Mb2Tomato-2A (IG154)
Plasmid#99620PurposeTo clone gene of interest downstream of FRT2-Mb2Tomato-2A cassetteDepositorInsertMb2Tomato
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT3-HA-H2B-Cerulean-2A (IG158))
Plasmid#99624PurposeTo clone gene of interest downstream of FRT3-HA-H2B-Cerulean-2A cassetteDepositorInsertHA-H2B-Cerulean
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-Puro
Plasmid#110852PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRPM7 gRNA (BRDN0001145424)
Plasmid#76113Purpose3rd generation lentiviral gRNA plasmid targeting human TRPM7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNAP-Rab6a
Plasmid#248793PurposeExpresses SNAP-Rab6a (WT) in mammalian cells. Generated from Addgene #46781 plasmid.DepositorAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ProteinC
Plasmid#242774PurposeAAV transfer plasmid expressing eGFP-ProteinC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsProteinCPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-Tag100
Plasmid#242779PurposeAAV transfer plasmid expressing eGFP-Tag100 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsTag100PromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-SPOT
Plasmid#242777PurposeAAV transfer plasmid expressing eGFP-SPOT under a CAG promoter.DepositorInsertEGFP
UseAAVTagsSPOTPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ALFA
Plasmid#242764PurposeAAV transfer plasmid expressing eGFP-ALFA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsALFAPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-AU5
Plasmid#242765PurposeAAV transfer plasmid expressing eGFP-AU5 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsAU5PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-E2
Plasmid#242766PurposeAAV transfer plasmid expressing eGFP-E2 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsE2PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ETAG
Plasmid#242767PurposeAAV transfer plasmid expressing eGFP-ETAG under a CAG promoter.DepositorInsertEGFP
UseAAVTagsETAGPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MoonTag
Plasmid#242770PurposeAAV transfer plasmid expressing eGFP-MoonTag under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMoonTagPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MYC
Plasmid#242771PurposeAAV transfer plasmid expressing eGFP-MYC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMYCPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-NWS
Plasmid#242772PurposeAAV transfer plasmid expressing eGFP-NWS under a CAG promoter.DepositorInsertEGFP
UseAAVTagsNWSPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-OLLAS
Plasmid#242773PurposeAAV transfer plasmid expressing eGFP-OLLAS under a CAG promoter.DepositorInsertEGFP
UseAAVTagsOLLASPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-S1
Plasmid#242775PurposeAAV transfer plasmid expressing eGFP-S1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsS1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-SunTag
Plasmid#242776PurposeAAV transfer plasmid expressing eGFP-SunTag under a CAG promoter.DepositorInsertEGFP
UseAAVTagsSunTagPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-TY1
Plasmid#242780PurposeAAV transfer plasmid expressing eGFP-TY1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsTY1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-cCGNL1-HA
Plasmid#236517PurposeFor expression of Paracingulin (dog) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-mCGNL1
Plasmid#236519PurposeFor expression of Paracingulin (mouse) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-cCGN-Myc
Plasmid#236506PurposeFor expression of CGN (dog) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #1
Plasmid#228932PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiCh2-2
Plasmid#229021PurposeExpression of a CRISPRi doxycycline inducible control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #8
Plasmid#228934PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC177_CCR5(PGK-synEPOR)
Plasmid#232415PurposeAAV production plasmid for PGK(synEPOR) vector from Figs. 3-5 that mediates HDR at CCR5 locus using CCR5 gRNA. synEPOR is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC176_EPOR(2A-synEPOR)
Plasmid#232414PurposeAAV production plasmid for EPOR(synEPOR) vector from Figs. 3-5 that mediates HDR at EPOR locus using EPOR gRNA. synEPOR is codon diverged to prevent premature recombination with EPOR locus.DepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-DHFR-3xFLAG
Plasmid#217428PurposeLentiviral overexpression of human DHFRDepositorInsertDHFR (DHFR Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert sequence is a codon-optimized gBLOCK (IDT)PromoterCMVAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_3
Plasmid#217434PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 3 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL3-WPRE-UbC-Emerald
Plasmid#225946PurposeLentiviral vector plasmid expressing human atlastin GTPase 3 (ATL3) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro XLone-CCND2
Plasmid#179845Purposedonor plasmid for inducible expression of CCND2 in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR, Luciferase, and TALEN ; Donor plasmidExpressionMammalianPromoterTRE3GSAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-4
Plasmid#218799PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-4
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only