We narrowed to 395 results for: asns
-
Plasmid#70085PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to bind iron in either the N-lobe or the C-lobeN-lobeDepositorInsertmutated human serum transferrin (TF Human)
TagsHexa His tag and N-terminal signal peptide, 4 aa …ExpressionMammalianMutationAsn413 Asp, Asn611Asp, Tyr95Phe, Tyr188Phe, Ty426…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-CD20-Puro
Plasmid#209757PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCD20
Plasmid#209749PurposeLentiviral transfer plasmid to express Cas9 and a gRNA targeting the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-CD20-Puro
Plasmid#209755PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-CD20-Puro
Plasmid#209756PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag::UbvG08 I44A, deltaGG
Plasmid#74939PurposeUbiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53). Blocks 53BP1 from accumulating at sites of DNA damage. Potent selective inhibitor of 53BP1DepositorInsertUbiquitin
TagsFlagExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMX-HA-UbvG08-IRES-GFP
Plasmid#75030PurposeRetroviral vector with ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A mutation and no terminal GlycinesAvailable SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMX-HA-UbvG08_MUT-IRES-GFP
Plasmid#75031PurposeRetroviral vector with ubiquitin variant with reverted mutations L69P and V70L (i53-DM mutant)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A, P69L, and L70V mutations and no…Available SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-i53-DM
Plasmid#92171Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant that has reverted mutations L69P and V70L (i53-DM)DepositorInserti53-DM
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A, P69L, and L70V mutations and no…PromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-Flag::UbvG08 P69L, L70V, I44A, deltaGG
Plasmid#74940PurposeUbiquitin variant with mutations L69P and V70L reverted to wild type (i53-DM mutant)DepositorInsertUbiquitin
TagsFlagExpressionMammalianMutationUbvG08 with I44A, P69L, and L70V mutations and no…PromoterCMVAvailable SinceMay 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD9-pHuji
Plasmid#130906PurposeExpression of CD9-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD9-pHuji (CD9 Synthetic, Human)
TagspHujiExpressionMammalianMutationpHuji inserted between Asn50 and Asn51 in extrace…PromoterCMVAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G-Beta
Plasmid#177962PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (Beta: K417N, E484K, N501Y, D614G)DepositorInsertSARS-CoV-2 Spike protein (Beta: K417N, E484K, N501Y, D614G) (S )
ExpressionMammalianMutationK417N, E484K, N501Y, D614GAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G-Epsilon
Plasmid#177964PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (Epsilon: S13I, W152C, L452R, D614G)DepositorInsertSARS-CoV-2 Spike protein (Epsilon: S13I, W152C, L452R, D614G) (S )
ExpressionMammalianMutationS13I, W152C, L452R, D614GAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G-K417N
Plasmid#177969PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (D614G, K417N)DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G-N439K
Plasmid#177970PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (D614G, N439K)DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G-L452R
Plasmid#177971PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (D614G, L452R)DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only