We narrowed to 5,461 results for: pAAV
-
Plasmid#192602PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DIO-GRAB_CRF1.0
Plasmid#208662PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
UseAAVPromoterEFSAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEO-CaMKII-EGFP
Plasmid#177018PurposeFor expression of EGFP in a single-floxed, excisable open reading frame (cre-off), under control of the CaMKIIa promoterDepositorInsertEGFP
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-alphaCaMKII-E2-Crimson-3XNLS-pA
Plasmid#183803PurposeAAV vector to express nuclear localized E2-Crimson from CaMKIIa promoterDepositorInsertE2-Crimson-NLS
UseAAVTagsNLSAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synp-F-H2B-GCaMP6f
Plasmid#102994PurposeExpresses histone fused GCaMP6f under the synapsin promoterDepositorInsertH2B-GCaMP6f
UseAAVExpressionMammalianPromoterhuman synapsin I promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only