We narrowed to 8,673 results for: reporter
-
Plasmid#82509PurposeVector targeting the Firefly Luciferase (Luc2) gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Meo gene.DepositorInsertLuc2-IRESMeo
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EHC
Plasmid#112619Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsVenusExpressionMammalianPromoterCAGAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHC
Plasmid#112615Purposepromoterless expression plasmid driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsEmeraldExpressionMammalianPromoterNo PromoterAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC
Plasmid#112616Purposepromoterless expression plasmid driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsmTeal (mTFP1)ExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-LacZ-IRESMuro
Plasmid#82507PurposeVector targeting the LacZ gene to the GAPDH locus of human cells. LacZ is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertLacZ-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(sgRNA-T2)-Chimeric_BB-CBh-hSpCas9
Plasmid#223323PurposeHuman codon optimized Cas9 expressing plasmid that carries the sgRNA T2 from Mali et al., 2013 (10.1126/science.1232033).DepositorInsertSpCas9 and sgRNA-T2 (cas9 )
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-iRFP-caax (JDW 1216)
Plasmid#224496PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and iRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-iRFP-caax
UseGateway CloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-HaloTag-KRas4B(CT)
Plasmid#214276PurposeMammalian expression of HaloTag fused to the C-terminal tail of KRas4BDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHES7-NLuc-2A-tdTomato
Plasmid#204348PurposeDonor vector to tag endogenous pig HES7 locusDepositorInsertNLuc-2A-tdTomato
TagsNanoLuc and tdTomatoExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmTHC_PGKneoLox2DTA.2
Plasmid#112624PurposeH2BmTeal_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsmTeal (mTFP1)PromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Clover-Muro
Plasmid#82334PurposeVector targeting the Clover gene to the GAPDH locus of human cells. Clover is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertClover-T2AMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMeo
Plasmid#82502PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. G418 resistance is encoded by the Meo gene.DepositorInserteGFP-IRESMeo
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNL [NlucP/SIE/Hygro] Vector
Plasmid#236833PurposeExpress SIE response element in luciferase reporter assayDepositorHas ServiceDNAInsertSIE
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNL [NlucP/ISRE/Hygro] Vector
Plasmid#236834PurposeExpress ISRE response element in luciferase reporter assayDepositorHas ServiceDNAInsertISRE
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-puro-cOVA-IRES-BFP
Plasmid#135074PurposeExpresses chicken cytoplasmic ovalbumin in lentiviral vector with puromycin resistance. cOVA is coupled with BFP fluorescent reporter using IRES.DepositorAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pNL [NlucP/CRE/Hygro] Vector
Plasmid#236829PurposeExpress CRE response element in luciferase reporter assayDepositorHas ServiceDNAInsertCRE
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits