We narrowed to 5,815 results for: 129
-
Plasmid#19189DepositorInsertCellular retinoic acid binding protein 1 (CRABP1 Chicken)
ExpressionBacterialAvailable SinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
GST-PC-2-CTS
Plasmid#86068PurposeA bacterial expression plasmid encoding polycystin-2 ciliary targeting signal with N-terminus GST-tag.DepositorInsertPolycystin-2 (Pkd2 Human)
TagsGSTExpressionBacterialMutationcontains the region from 1-15PromotertacAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLIA CRX EnR (CC#145)
Plasmid#15155DepositorInsertCRX (Crx Mouse)
UseRetroviralTagsEngrailed RepressorExpressionMammalianMutationamino acids 7–108, containing the CRX homeoboxAvailable SinceJune 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pet 3d beta tentacle delete CP
Plasmid#13300DepositorInsertcapping protein alpha 1 beta 1 (deletion 28 amino acids ) (CAPZB Chicken)
ExpressionBacterialMutationCP alpha subunit is intact with a mutated beta C-…Available SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-vhhGFP-CRY2
Plasmid#248298PurposeAn expression construct encoding a GFP nanobody (vhhGFP) fused to CRY2.DepositorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pHCF/V5
Plasmid#247002PurposeExpresses HCF-1 with carboxy terminal V5 tag under the control of the CMV promoterDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pAAV CMV-hTau-T2A-EGFP-WPRE3-BGHpA
Plasmid#240284PurposeThe plasmid will package wild-type human Tau (hMAPT) as a T2A fusion with EGFP from a CMV promoterDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only