We narrowed to 5,560 results for: Chia
-
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
UseTagsExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
eMscL WT
Plasmid#107454PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia Coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationPromoterhuman synapsin 1Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA228-pro4IUPi
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsUseTagsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pLV_EF1a-NAE1_IRES_Puro
Plasmid#235659Purposehuman NAE1 cloned into into lentiviral backbone (pLV-EF1a-IRES-Puro)DepositorInsertNAE1 (NAE1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHtrA-TEV-His12
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-KIF1Bbeta tail 387-1770
Plasmid#134620PurposeMammalian expression of mouse KIF1Bbeta 387-1170DepositorInsertKIF1Bbeta (Kif1b Mouse)
UseTagseGFPExpressionMammalianMutationWT with deletion of the 386 N-terminal residues.PromoterChicken Beta actinAvailable sinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 Flag-LplA
Plasmid#232118PurposeFor bacterial expression of Flag-tagged E. coli LplA.DepositorInsertlplA (lplA Escherichia coli (strain K12))
UseTagsFlagExpressionBacterialMutationPromoterT7 PromoterAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-1.7kbfabp6
Plasmid#159087Purposep5E with promoter sequence 1.7kb upstream of zebrafish fabp6 geneDepositorInsert1.7kb fabp6 promoter (fabp6 Zebrafish)
UsePromoter fragment 5' entry vector for tol2 c…TagsExpressionMutationPromoter1.7kb fabp6Available sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCb.CAG-HaloTag-GA-ZF-KrabA-KIF5A 378-1027
Plasmid#134611PurposeMammalian expression of mouse KIF5A 378-1027DepositorInsertKIF5A (Kif5a Mouse)
UseTagsHaloExpressionMammalianMutationWT with deletion of the 377 N-terminal residues.PromoterChicken Beta actinAvailable sinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDipA-TEV-His12
Plasmid#137042Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi DipA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-TEX264-deltaLRR-cSSH
Plasmid#220210PurposeMammalian expression of TEX264, 2-25 residues (LRR) truncated, C-terminal twin-Strep_HA tagDepositorInsertTEX264 (TEX264 Human)
UseTagsStrep-strep-HAExpressionMammalianMutationc.4-75del / p.2-24delPromoterCMV/TetOAvailable sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR(NGS-6)-mCherry
Plasmid#217363PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA mutant, "NGS-6"
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-pro-alphaf(I)-E2-Crimson
Plasmid#117660PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf(I)-E2-Crimson
UseTagsExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-KIF1Balpha tail 387-1150
Plasmid#134619PurposeMammalian expression of mouse KIF1Balpha 387-1150DepositorInsertKIF1Balpha (Kif1b Mouse)
UseTagseGFPExpressionMammalianMutationWT with deletion of the 386 N-terminal residues.PromoterChicken Beta actinAvailable sinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pOst1-pro-alphaf(MUT1)-E2-Crimson
Plasmid#117662PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpOst1-pro-af(MUT1)-E2-Crimson
UseTagsExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBA57-TEV-His12
Plasmid#137033Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BBA57 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66270.1 (BB_A57 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length BBA57, contains signal pep…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSET-XS-VWF
Plasmid#64847PurposeExpresses aa1594–1670 of VWF A2 domain flanked by Venus and Cerulean and tagged with 7X His at C terminusDepositorInsertVenus_VWF A2 domain aa 1594-1670_Cerulean_TEV_7X His (VWF Human, Synthetic)
UseTags7X His, Cerulean, and VenusExpressionBacterialMutationPromoterT7Available sinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralTagsExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…PromoterAvailable sinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only