We narrowed to 7,993 results for: 104

#254562

For the expression of the Mokosh type I system encoded by Escherichia coli ETEC H10407

Philip Kranzusch

April 8, 2026

Academic Institutions and Nonprofits only

#110422

shLuc control, silence Luc gene, doxycycline inducible, puromycin selection

Sandra Martha Gomes Dias

June 19, 2018

Academic Institutions and Nonprofits only

#192104

Bacterial expression of human wild-type short-form UBASH3A with GST tag

Patrick Concannon

Dec. 15, 2022

Academic Institutions and Nonprofits only

#250223

Express Protein2PAM_NmeN4CNNT.2 nuclease in human cells using a CMV promoter

Ali Madani

March 4, 2026

Academic Institutions and Nonprofits only

#231104

Expresses FabI under T7 with HIS tag

Josh Beckham

March 17, 2025

Academic Institutions and Nonprofits only

#110426

TRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

June 20, 2018

Academic Institutions and Nonprofits only

#166104

This plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination

Matthias Heinemann

April 14, 2021

Academic Institutions and Nonprofits only

#121041

MoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.

Richard Murray

Dec. 4, 2019

Academic Institutions and Nonprofits only

#210431

Expresses ER-targeted split-CFAST10 for Short-Range ER-Mito Contact sites

Tito Calì

Nov. 21, 2023

Academic Institutions and Nonprofits only

#35104

John McCusker

Hartzog et al Yeast. 2005 Jul 30;22(10):789-98.

Aug. 29, 2012

Academic Institutions and Nonprofits only