We narrowed to 10,138 results for: tre promoter
-
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pM-Cas12a
Plasmid#196291Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding LbCas12a in place of viral GPDepositorInsertFull length TSWV M antigenome encoding LbCas12a in place of viral GP (cas12a Synthetic)
UseCRISPRTagsFlagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR RPS27A K107/113R-3xFlag_IRES-GFP
Plasmid#198392PurposeRPS27A K107/113R (ubiquitin/ribosomal protein eS31 fusion) expressionDepositorInsertRPS27A (RPS27A Human)
UseLentiviralTags3xFlagExpressionMammalianMutationubiquitination site double mutant (K107/113R)PromoterEF1AAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2–mPKCε-CAT-HA
Plasmid#190483PurposeExpresses a fluorescently-tagged, optogenetically activated PKC-epsilon. Used in tandem with CIBN-CAAXDepositorInsertmCherry-CRY2–mPKCε-CAT-HA (Prkce Synthetic, Mouse)
TagsFused to CRY2, HA, and mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1 pET151
Plasmid#159384PurposeExpresses human TLNRD1 in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUN1243 - pL0_pT3O (pro + 5U)
Plasmid#203891PurposeT3O promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT3O promoter and 5'UTR
ExpressionPlantAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1198 - pL0_pD4H (pro + 5U)
Plasmid#203894PurposeD4H promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertD4H promoter and 5'UTR
ExpressionPlantAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFB2gRNA13
Plasmid#196107PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-Cterm-V5His6_H
Plasmid#146488PurposeInsect Expression of DmPABPC1-CtermDepositorInsertDmPABPC1-Cterm (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-Nterm-V5His6_H
Plasmid#146489PurposeInsect Expression of DmPABPC1-NtermDepositorInsertDmPABPC1-Nterm (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-DmPABPC1-Nterm-V5His6_H
Plasmid#146478PurposeInsect Expression of DmPABPC1-NtermDepositorInsertDmPABPC1-Nterm (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182_1-830-dsRNAres_G
Plasmid#146388PurposeInsect Expression of DmGW182_1-830-dsRNAresDepositorInsertDmGW182_1-830-dsRNAres (gw Fly)
ExpressionInsectMutationtwo non silent mutations V704A and N799S, and one…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182_1-1115-dsRNAres_G
Plasmid#146389PurposeInsect Expression of DmGW182_1-1115-dsRNAresDepositorInsertDmGW182_1-1115-dsRNAres (gw Fly)
ExpressionInsectMutationtwo non silent mutations V704A and N799S, and one…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-PAM26B-F1370A-dsRNAres_L
Plasmid#146838PurposeInsect Expression of DmGW182-PAM26B-F1370A-dsRNAresDepositorInsertDmGW182-PAM26B-F1370A-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-SD6B-F13170A-dsRNAres_L
Plasmid#146841PurposeInsect Expression of DmGW182-SD6B-F1370A-dsRNAresDepositorInsertDmGW182-SD6B-F1370A-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM-41-DmPABPC1_1-390_L
Plasmid#146866PurposeBacterial Expression of DmPABPC1_1-390DepositorInsertDmPABPC1_1-390 (pAbp Fly)
ExpressionBacterialMutation4 silent mutations compared to the sequence geven…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182_1-1199-delDUF-M2-dsRNAres_L
Plasmid#146821PurposeInsect Expression of DmGW182_1-1199-delDUF-M2-dsRNAresDepositorInsertDmGW182_1-1199-delDUF-M2-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only