We narrowed to 12,418 results for: BASE
-
Plasmid#199390PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag, biotin acceptor peptide (Avi), and SUMOEu tagDepositorInsertanti-ALFA nanobody
UseTags14xHis-Avi-SUMOEuExpressionBacterialMutationPromoterT5-LacOAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 (NT17)
Plasmid#49085PurposeExpresses human NKCC1 with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and mVenusExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable sinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
dCas9-dMSK1
Plasmid#165602PurposeExpresses Sp dCas9 fused to truncated human MSK1 (42-802)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated human Mitogen- and stress-activated protein kinase-1 (42-802) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be remove for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-tdTomato-P2A-BlasR (LRT2B)
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralTagsExpressionMutationWTPromoterU6Available sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-dTAG-LMNB1
Plasmid#207776PurposeDonor template for Blast-2A-dTAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-dTAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin
Plasmid#118710PurposeLentiviral TET-ON inducible GFP-ProgerinDepositorInsertGFP-Progerin (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationPromoterCMV TRE3G (TET-ON)Available sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.D2-NP
Plasmid#134366PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.DepositorInsertD2-NP (DRD2 Human)
UseTagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianMutationPromoterT7Available sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-VP64
Plasmid#47107PurposeExpresses inactivated S. pyogenes dCas9 (D10A, H840A) fused to VP64 transactivator domain in mammalian cellsDepositorInsertdCas9-VP64
UseCRISPRTagsFlag, HA, SV40 NLS, and VP64ExpressionMammalianMutationD10A, H840A (catalytically inactive)PromoterCMVAvailable sinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable sinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Plasmid#140002PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP-GRAM-W
Plasmid#211704PurposeLentiviral expression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187W mutation (pLJM1-EGFP-GRAM1b G187W)DepositorInsertEGFP-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3A-eBE-Y130F
Plasmid#113423PurposeExpresses hA3A-eBE-Y130F in mammalian cellsDepositorInserthA3A-eBE-Y130F (APOBEC3A Human, S. pyogenes and Bacteriophage PBS2)
UseCRISPRTagsExpressionMammalianMutationhAPOBEC3A_Y130FPromoterCMVAvailable sinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7
Plasmid#11795Purpose3rd generation lentiviral vector that expresses shRNA under the mouse U6 promoter. A CMV-EGFP reporter cassette is included in the vector to monitor expression.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromotermouse U6Available sinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PM-RA-BlastR
Plasmid#211708PurposeLentiviral expression of a ddFP subunit (RA) fused with the lipid modification motif of lymphocyte-specific protein tyrosine kinase (Lck) for plasma membrane (PM) targetting (PM-RA)DepositorInsertPM-targetted RA (Lck Synthetic)
UseLentiviralTagsRAExpressionMammalianMutationPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)
Plasmid#90086PurposeThis plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-P2A-Puro
Plasmid#110837PurposeLentiviral vector for expression of Cas9 in mammalian cells (codon optimized)DepositorInsertCas9
UseLentiviralTagsExpressionMutationWTPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (fl)
Plasmid#137824Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (fl) (CD44 Human)
UseTagsGFPExpressionMammalianMutationfull length and mutations A282T, T483A, N535D, S5…PromoterPGKAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpCas9-NG-P2A-EGFP (RTW4564)
Plasmid#140005PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9-NG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 EGFPC2 TAZ
Plasmid#66850PurposeExpress GFP-fused TAZ by lentivirusDepositorInsertWWTR1/TAZ (WWTR1 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-4
Plasmid#228986PurposeFor bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-4
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-2
Plasmid#228996PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-2, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-2
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-12
Plasmid#228999PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-12, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-12
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-15
Plasmid#228971PurposeFor bacterial expression of anti-GFP nanobody LaG94-15, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-15
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-3
Plasmid#228985PurposeFor bacterial expression of anti-GST nanobody GST-3, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-3
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-14
Plasmid#228994PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-14, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-14
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-39
Plasmid#228980PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-39, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertLaTdT-39
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiBE3-SpRY-Blast
Plasmid#199303PurposeExpresses SpRY Cas9 nickase cytosine base editor FNLS-BE3 and blasticidin resistanceDepositorInsertFNLS-BE3-SpRY
UseCRISPR and LentiviralTags2A tagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRTagsExpressionBacterialMutationD10A, H840APromoterxylAAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorInsertsgRNA Targeting N-terminus of ACTB (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-LAMP1
Plasmid#207788PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the LAMP1 locus. For lysosome visualization.To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a moxGFP-Puro Cassette (LAMP1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCWori cytochrome P450-BM3h 9D7
Plasmid#61308PurposeExpresses Cytochrome P450-BM3h 9D7 with C-terminal 6-His tagDepositorInsertCytochrome P450-BM3 heme domain 9D7
UseTags6xHisExpressionBacterialMutationT268A, I263A, T438V, A328GPromoterTacAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CANX
Plasmid#227281PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CANX locus. For cilia visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold-2A-Puro Cassette (CANX Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRTagsExpressionBacterialMutationPromotervegAvailable sinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only