We narrowed to 24,121 results for: CRISPR
-
Plasmid#90687Purpose3rd generation lentiviral gRNA plasmid targeting human FBXO5DepositorInsertFBXO5 (Guide Designation D4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F1.1 gRNA
Plasmid#90744Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F1.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F2.1 gRNA
Plasmid#90745Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA M4
Plasmid#80937PurposeExpresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTE_10 - pCMV-Cas9_only
Plasmid#252006PurposeMammalian expression of Cas9DepositorInsertCas9
UseCRISPRExpressionMammalianMutationNAAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
p305N-31 (nonfunctional)
Plasmid#246314PurposeEvaluation of PtU6.2c4 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2c4 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationdeletions: -A (-41 from TSS), -T (-30), -T (-29);…PromoterPtU6.2c4 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-9 (nonfunctional)
Plasmid#246292PurposeEvaluation of AtU6.29c13 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.29c13 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationdeletions: -A (-58 from TSS), -T (-57) within USEPromoterAtU6.29c13 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-17 (nonfunctional)
Plasmid#246300PurposeEvaluation of HbU6.2m3 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m3 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationC-to-T (-29 from TSS), G-to-A (-24)PromoterHbU6.2m3 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-26 (nonfunctional)
Plasmid#246309PurposeEvaluation of MtU6.6m7 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m7 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationC-to-A (-63 from TSS), T-to-G (-57)PromoterMtU6.6m7 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM2_Euk_2NLS-RVQ (LbCas12a)-2NLS
Plasmid#244837PurposeMammalian expression of LbCas12a-RVQ with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a-RVQ
UseCRISPRTags2xSV40 NLSExpressionMammalianMutationG146R/R182V/E795QPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM1_Euk_2NLS-WT ( LbCas12a)-2NLS
Plasmid#244836PurposeMammalian expression of wild-type LbCas12a with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a
UseCRISPRTags2xSV40 NLSExpressionMammalianPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMKR07
Plasmid#240097PurposeA CRISPR‑Cas9 system for knock‑out and knock‑in of high molecular weight DNA enables module‑swapping of the pikromycin synthase in its native hostDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialPromoterermE* promoterAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT44
Plasmid#223416PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT49
Plasmid#223421PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only