We narrowed to 24,055 results for: crispr
-
Plasmid#246309PurposeEvaluation of MtU6.6m7 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m7 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationC-to-A (-63 from TSS), T-to-G (-57)PromoterMtU6.6m7 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM2_Euk_2NLS-RVQ (LbCas12a)-2NLS
Plasmid#244837PurposeMammalian expression of LbCas12a-RVQ with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a-RVQ
UseCRISPRTags2xSV40 NLSExpressionMammalianMutationG146R/R182V/E795QPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM1_Euk_2NLS-WT ( LbCas12a)-2NLS
Plasmid#244836PurposeMammalian expression of wild-type LbCas12a with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a
UseCRISPRTags2xSV40 NLSExpressionMammalianPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMKR07
Plasmid#240097PurposeA CRISPR‑Cas9 system for knock‑out and knock‑in of high molecular weight DNA enables module‑swapping of the pikromycin synthase in its native hostDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialPromoterermE* promoterAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT44
Plasmid#223416PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT49
Plasmid#223421PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p223-Pulse-Switch
Plasmid#217889PurposeLentiviral Pulse-Switch vector for sgRNA expression, Cas9 and sgRNA expression are mutual exclusive; blastiRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterLrk004PAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only