We narrowed to 6,170 results for: cas9 expression plasmid
-
Plasmid#84365PurposeCas9-gRNA plasmid for mouse Cbfa2t2 KnockoutDepositorInsertCbfa2t2-gRNA2
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
TU#1805_CRISPR_unc-73_exon2
Plasmid#82359Purposeto create unc-73B null alleleDepositorInsertCas9 and sgRNA against unc-73 exon2 (unc-73 Nematode)
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
bRA77
Plasmid#100953PurposeGAL1 driven Cas9. gRNA can be cloned into BplI sites.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
bRA66
Plasmid#100952PurposeGAL1 driven Cas9. gRNA can be cloned into BplI sites.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAIO3
Plasmid#137844PurposeCas9 and gRNA expression plasmid for P. falciparum; no selection in parasites.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK1520_blastR
Plasmid#175289PurposeHuman expression plasmid for SpCas9 sgRNA with blasticidin co-selectionDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCMV/U6Available sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgCRY1
Plasmid#176511PurposeExpresses sgRNA in mammalian cellsDepositorUseAAVTagsmCherry (K14E, N210D, E249G)ExpressionMutationPromoterU6, hSynAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_118
Plasmid#113667PurposeLentiviral vector expressing dCas9DepositorInsertdCas9
UseCRISPR and LentiviralTagsExpressionMutationcatalytically inactivePromoterAvailable sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGE31
Plasmid#50929PurposeExpressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRice snoRNA U3 and dual 35S promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
p458 VQR
Plasmid#101727PurposeExpresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifsDepositorInsertSpCas9 VQR
UseTagsExpressionMammalianMutationVQRPromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459 EQR
Plasmid#101732PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
UseTagsExpressionMammalianMutationVQRPromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorInsertPMR1 gRNA (PMR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorInsertLUG1 gRNA (YLR352W Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only