We narrowed to 3,813 results for: biorxiv
-
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME Lamin B Vhh mNeonGreen-pA (JDW 1312)
Plasmid#224501PurposeGateway compatible middle entry clone containing Lamin B nanobody fused to mNeonGreen with HA Tag (For visualizing the nuclear lamina, lamin chromobody)DepositorInsertLamin B Vhh mNeonGreen-pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable sinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF153_Gag-Pol
Plasmid#225961PurposeCMV-Intron-GagPol (FMLV). Expresses FMLV (Friend Murine Leukemia Virus) Gag-Pol for VLP production.DepositorInsertCMV-Intron-GagPol (FMLV)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF160_VSV-G
Plasmid#225963PurposeCMV-Intron-VSVG (env protein). Expresses VSV-G env for VLP production.DepositorInsertCMV-Intron-VSVG (env protein)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorInsertsgRNA targeting DNA-PKcs (PRKDC) exon 1 (PRKDC Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Sun1-2xsfGFP-6xMYC-pA (JDW 681)
Plasmid#224489PurposeGateway compatible middle entry clone containing Sun1 reporter fusion to 2 copies of sfGFP and 6 MYC tags (Nuclear envelope reporter and affinity tag)DepositorInsertSun1-2xsfGFP-6xMYC-pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg2 hp
Plasmid#218094PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF140_Gag-SpyCas9-NLS
Plasmid#225959PurposeCMV-Intron-Gag-SpyCas9-NLS. Expresses Gag-SpyCas9-NLS for VLP production.DepositorInsertCMV-Intron-Gag-SpyCas9-NLS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME Actin Vhh mNeonGreen-HA-pA (JDW 1248)
Plasmid#224500PurposeGateway compatible middle entry clone containing Actin nanobody fused to mNeonGreen with an HA tag (Visualizing actin, actin chromobody)DepositorInsertActin-Vhh-mNeonGreen-HA-pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorInsertSYK (SYK Human)
UseTagsHis6-TEVExpressionBacterialMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-pTau nanobody (A2) with sortase tag
Plasmid#233218PurposeMammalian epression of anti-pTau nanobody (A2) with a sortase tag for direct dye conjugation.DepositorInsertAnti-pTau nanobody (A2)
UseTagsSortase tag, His tagExpressionMammalianMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mCherryBSD
Plasmid#225697PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1304-AAV-EFSNC-dCjCas9-KRAB-MECP2
Plasmid#223149PurposeExpression of KRAB and truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB-TetOn-DEST-hEF1a-mODC-rtTA-IRES-NEO (JDW 1130)
Plasmid#229839PurposeA CAGGS driven, piggybac compatible, tet-on expression vector containing a luciferase reporter followed by a P2A cleavage peptide and H2A fused mCherry for nuclear labeling.DepositorInsertLuciferase
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only