We narrowed to 10,053 results for: transfer
-
Plasmid#199583PurposeExpresses NLS-mRuby3 in a Cre-dependent mannerDepositorInsertNLS-mRuby3
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterU6 and EF1aAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianPromoterSynapsinAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF130 shRNA
Plasmid#225340PurposeshRNAmir backbone for RNA interference, with YFPDepositorAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-2A-IvfChr (citrine, KV2.1)
Plasmid#221619PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151T) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-2A-IvfChr (mCherry, KV2.1)
Plasmid#221621PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-mCHerry with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-mCherry-Kv2.1
UseAAVMutationZipACR (I151T) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-2A-IvfChr (citrine, KV2.1)
Plasmid#221618PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151V) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552 EF1a DIO Chronos GFP_Vgat gRNA
Plasmid#215277PurposeExpresses Vgat gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552 EF1a DIO Chronos GFP_VgatTTT gRNA
Plasmid#215278PurposeExpresses Vgat Control gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat control gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-hSyn-DIO-GCaMP8f_Grin1 gRNA
Plasmid#215281PurposeExpresses Grin 1 gRNA in a Cre dependent GCaMP8f vectorDepositorInsertGrin1 gRNA
UseAAVExpressionMammalianMutationSee Depositor Comments BelowPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pssAAV_Seq17_CMV_bglobin_3NLS_TFP_WPRE_polyA
Plasmid#220223PurposeAAV-STARR-seq validation control vector with TFPDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G12-hFGF1
Plasmid#219554PurposehFGF1 expression in mammalian cells. pAAV vector. Reporter plasmid.DepositorInserthFGF1 (FGF1 Human)
UseAAVExpressionMammalianPromoter12xUAS with TATA-box minimal promoterAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-YTH-EGFP
Plasmid#209322PurposeAAV packaging vector containing a APOBEC1-YTH expression, a P2A-EGFP expression cassette,.DepositorInsertAPOBEC1-YTH-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EGFP-APOBEC1-YTH
Plasmid#209319PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTH cassette.DepositorInsertAPOBEC1-YTH-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS_LF
Plasmid#213394PurposeLoss of function variant of uMASS_1 opioid sensor. AAV virus production for Cre dependent expression.DepositorInsertuMASS_LF
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVPromoterCMVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
Plasmid#206968PurposeExpresses TadA8e and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA8e, SpG N
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA
Plasmid#206979PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertLmna sgRNA
UseAAV; Adenine base editorPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only