We narrowed to 20,535 results for: Kin
-
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
ExpressionPlantPromoterpNOSAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX026
Plasmid#167153PurposeMoClo-compatible Level 1 (position 4) vector encoding Neonothopanus nambi luciferase nnLuz with C-terminal His-tag under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnLuz-ocsT
UseLuciferaseTagsHis6-tagExpressionPlantPromoterp35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX037
Plasmid#167156PurposeMoClo-compatible Level2 vector for autonomous bioluminescence in plants encoding kanamycin resistance cassette, nnHispS, nnH3H, nnLuz and nnCPH. Does not contain NpgA.DepositorInsertcaffeic acid cycle genes
ExpressionPlantPromoterpNOS, p35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNK7187
Plasmid#219761PurposeMoClo-compatible Level 1 for expression PpASCL in plants (N.benthamiana, BY2 cells)DepositorInsertPpASCL
ExpressionPlantPromoterp35s_0.4kb - 5'UTR TMV omegaAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK091
Plasmid#219769PurposeMoClo-compatible Level P vector carrying fungal bioluminescence system lacking luciferase geneDepositorInsertpNos-KanR-ocsT | p35S-nnHispS-ocsT | pCmYLCV-npgA-ATPT | p35S-nnCPH-ocsT | pFMV-nnH3H-nosT
UseSynthetic BiologyExpressionPlantPromoterpNos-KanR-ocsT | p35S-nnHispS-ocsT | pCmYLCV-npgA…Available SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK7190
Plasmid#219763PurposeMoClo-compatible Level M for expression nnLuz, nnH3H, nnCPH in plants (N.benthamiana, BY2 cells)DepositorInsertnnLuz, nnH3H, nnCPH
ExpressionPlantAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7183
Plasmid#219760PurposeMoClo-compatible Level 1 for expression PzPKS2 in plants (N.benthamiana, BY2 cells)DepositorInsertPzPKS2
ExpressionPlantPromoterp35s_0.4kb - 5'UTR TMV omegaAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7180
Plasmid#219762PurposeMoClo-compatible Level 1 for expression HmS in plants (N.benthamiana, BY2 cells)DepositorInsertHmS
ExpressionPlantPromoterp35s_0.4kb - 5'UTR TMV omegaAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Myc-tagged PSK (K57A)
Plasmid#197150PurposeExpression of kinase-deficient MYC-tagged PSK1-alpha (K57A) / TAOK2 (K57A) in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD
Plasmid#25049DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD-R1441C
Plasmid#25050DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD-Y1699C
Plasmid#25051DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBabe-kappa-HA-dL5-myc-ADRB2
Plasmid#101253PurposeExpresses HA-dL5(E52D)-cMyc N-terminal fusion of beta-2 adrenergic receptor in mammalian cells, MMLV retroviral plasmid (MBIC5, dL5**, FAP, ADRB2)DepositorInsertkappa-HA-dL5-myc-ADRB2 (ADRB2 Budding Yeast, Human)
UseRetroviralTagsFAP-dL5 and HA epitopeExpressionMammalianPromoterMMLV LTRAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pDONR223-MAP4K4
Plasmid#23486DepositorInsertMAP4K4 (MAP4K4 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAP4K1
Plasmid#23484DepositorInsertMAP4K1 (MAP4K1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAP4K2
Plasmid#23644DepositorInsertMAP4K2 (MAP4K2 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only