We narrowed to 3,846 results for: 28
-
Plasmid#209786PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoterDepositorInsertTNT4, TadA8e, SpRY N, inteinN
UseAAVPromoterTNT4Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔPrD(kf)-SNAP
Plasmid#166150PurposeExpression of N. furzeri DDX5ΔPrD(1-535) mutant in E. coliDepositorInsertDDX5ΔPrD(1-535)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔPrD(1-535)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔIDR(kf)-SNAP
Plasmid#166151PurposeExpression of N. furzeri DDX5ΔIDR(1-483) mutant in E. coliDepositorInsertDDX5ΔIDR(1-483)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔIDR(1-483)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR ins5 YD/FL-FLAG
Plasmid#214706PurposeMammalian expression of human CALR ins5 YD/FL-FLAGDepositorAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1a in pT3TS-Dest
Plasmid#194294PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1a from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LAIDepositorInsertcavin1a (cavin1a Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-HsNRF2 (NFE2L2)
Plasmid#194302PurposeMultisite gateway entry clone for expression of human NRF2 (NFE2L2) with fusion tag at the N-terminus. Parton lab clone KRSDepositorInsertNFE2L2 (NFE2L2 Human)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1a
Plasmid#194291PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1a with fusion tag at the N-terminus. Parton lab clone KXMDepositorInsertcavin1a (cavin1a Zebrafish)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free ClLIS1 (M)
Plasmid#182484PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and limonene synthase from Citrus limon (ClLIS1; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
LS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dMET
Plasmid#176031PurposeA knock-out vector for dog METDepositorInsertA gRNA targeting the dog MET gene and the cDNA of Cas9 (MET )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gucy1b2-IRES-nlsCre-IRES-taulacZ-FNF TV
Plasmid#105196Purposetargeting vector to generate a Gucy1b2-IRES-nlsCre-IRES-taulacZ mouse strain.DepositorInsertGucy1b2-IRES-nlsCre-IRES-taulacZ-FNF (Gucy1b2 Mouse)
UseMouse TargetingAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1A-mCherry-StreptagII
Plasmid#158743PurposeExpresses K2P4.1 isoform A with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-A (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-264 with N-linked glycosylation sites …PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1B-mCherry-StreptagII
Plasmid#158744PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-B (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-290 and N-linked glycosylation sites r…PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIB1 gRNA (BRDN0001147177)
Plasmid#76949Purpose3rd generation lentiviral gRNA plasmid targeting human CIB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CIB1 gRNA (BRDN0001147329)
Plasmid#76950Purpose3rd generation lentiviral gRNA plasmid targeting human CIB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CIB1 gRNA (BRDN0001147051)
Plasmid#76951Purpose3rd generation lentiviral gRNA plasmid targeting human CIB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-miR122 TS
Plasmid#209783PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoter, incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertmiR122 ts
UseAAVTagsHAPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only