We narrowed to 12,197 results for: SHA;
-
Plasmid#225666PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLVX-Flag-CDK19-W105M-IRES-ZsGreen
Plasmid#68859PurposeExpresses Human CDK19 W105M MutantDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Fyn-SH2-AviTag
Plasmid#214202PurposeBacterial expression of SH2 domain of the Fyn kinase (B- iso) with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Fgr-SH2-AviTag
Plasmid#214205PurposeBacterial expression of SH2 domain of the Fgr kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertFgr kinase SH2 domain (FGR Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg3_pX330
Plasmid#127340PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-NE
Plasmid#215487PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2E)-NE
Plasmid#215488PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to glutamate) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to EPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-GFP
Plasmid#215490PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2E)-GFP
Plasmid#215491PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to glutamate) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to EPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L188A/L192A
Plasmid#108288PurposeExpresses residues 186-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-286DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L192A/L195A
Plasmid#108290PurposeExpresses residues 186-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-287DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
18065-M01-412
Plasmid#225664PurposeLentiviral expression of FLAG-tagged fluorescent proteins for immunohistochemical detection in FFPE tissueDepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterSORE6-mCMVp and WPRE-SV40pAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only