We narrowed to 6,879 results for: crispr cas9 plasmids
-
Plasmid#112421PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF23DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pZNF134.1.0-gDNA
Plasmid#112416PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF134DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNR1D2.1.0-gDNA
Plasmid#112410PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NR1D2DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF354B.1.0-gDNA
Plasmid#112405PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF354BDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF75A.1.0-gDNA
Plasmid#112403PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF75ADepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDG330
Plasmid#100898PurposeSpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only