We narrowed to 27,982 results for: STI
-
Plasmid#88873Purposeconstitutive expression of DDX5 in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENPromoterCAGAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN1 ZEO
Plasmid#92245PurposeTALEN targeting downstream of HTT gene (KKR) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN2 BSD. TALEN: HD, NI, NN, HD, NG, NG, HD, HD, NG, HD, NI, NN, HD, HD, NN, HDDepositorInsertTALEN
UseTALENPromoterCAGAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP2443
Plasmid#72252PurposeHuman expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mScarlet-Blast
Plasmid#169221PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet-P2A-Blast at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet-P2A-Blast
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-TaqStoffel (JO595)
Plasmid#208952PurposeA variant CE1 construct with Taq Stoffel DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-TaqStoffel-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ2
Plasmid#197415PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-2 σ2 fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-2 σ2
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationencodes R42G substitution, contains silent substi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 proHB-EGF CS
Plasmid#11601DepositorInsertHB-EGF (HBEGF Human)
TagsHis and mycExpressionMammalianMutationConstitutively secreted HB-EGF: C-terminal amino …Available SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
Lenti-AcGFP-Sec61-IRES-Blast
Plasmid#154009PurposeLentiviral vector plasmid for integration and constitutive expression of AcGFP fused to Sec61 in mammalian cells – gift from D. Gerlich (IMBA, Vienna)DepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Polymerase-unfused click editor - pCMV-T7-PCV2-nCas9 (LM2702)
Plasmid#208961PurposePolymerase-unfused click editor comprised of PCV2 fused to nCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-WT
Plasmid#182741PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (WT) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase (ALOX5 Human)
UseCre/Lox and LentiviralExpressionMammalianMutationcodon optimized for expression in homo sapiensPromoterSFFVAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mNeongreen-Blast
Plasmid#169229PurposeTargeting vector backbone to support a knock-in of Linker-mNeongreen-P2A-Blast at the C-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen-P2A-Blast
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pR26-CMVconst-mBMP7
Plasmid#127375PurposeAllows for constitutive BMP7 expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Nickase SpCas9 - pCMV-T7-nSpCas9(H840A)-P2A-GFP (HES140)
Plasmid#208976PurposeNickase SpCas9 (H840A) with a P2A GFP and 3xFLAG, expressed from a CMV or T7 promoters.DepositorInsertnSpCas9(H840)-BPNLS-P2A-GFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
BlastR-P2A-DD-TCOF1-donor
Plasmid#60748PurposeDonor plasmid for HR-mediated recombination to insert blasticidin resistance and append a destabilization domain to the N-terminus of TCOF1DepositorInsertTCOF1 (TCOF1 Human)
UseTargeting donorAvailable SinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-TEV-SRC (Y530F)
Plasmid#223743PurposeExpression of recombinant protein for purificationDepositorInsertSrc Kinase (SRC Human)
TagsGST-TEVExpressionInsectMutationY530F constitutively active mutantAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUt-mPF-GFP
Plasmid#199222PurposeLPUtopia-7 matching RMCE donor plasmid with GFP Positive-Feedback circuit (mPF-GFP). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertrtTA-Advanced::P2A::EGFP
TagsEGFPExpressionMammalianPromotertight TRE promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRecLV105 MEF2C S222A
Plasmid#107239PurposeA lentiviral vector for expression in mammalian cells encoding MEF2C-S222A insertDepositorInsertMEF2C S222A
UseRetroviralExpressionMammalianAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-B103 (LM2963)
Plasmid#208960PurposeA variant CE1 construct with B103 DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-B103-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only