We narrowed to 5,000 results for: mos
-
Plasmid#176941PurposeMammalian expression vector encoding CRYZL1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pCA528 CHMP1B 4-199
Plasmid#115325PurposeExpresses residues 4-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-23DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-178
Plasmid#108284PurposeExpresses residues 4-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-279DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationdeleted amino acids 1-3 and 179-199Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ir7f-T2A-QF2 HDR plasmid
Plasmid#140942PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Ir7f geneDepositorInsertIr7f-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir7f-right-HDR-arm
Mutation4 point mutations (annotated on plasmid map) were…Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154A/H250Y
Plasmid#108489Purposeexpression of vsv-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLViN-E-cadherin-GFP
Plasmid#229710PurposeLentiviral expression of E-cadherin-GFPTG in mammalian cellsDepositorInsertCDH1 E-CADHERIN Human (CDH1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-B
Plasmid#66190Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-UBR5
Plasmid#52050PurposeCMV driven mammalian expression of UBR5 with an N-termianl GFP fusionDepositorAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcdna 3.1 DSG-3 Tension Sensor
Plasmid#182717Purposeexpresses DSG-3 TSmodDepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I tension sensor (F40-based)
Plasmid#119186PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between mTFP1 and mEYFP.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-N
Plasmid#66191Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), Neo selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only