We narrowed to 24,080 results for: c-myc
-
Plasmid#98677PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with N2ADepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationN1775A, N1782AAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_del1961-1970
Plasmid#98680PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with del1961-1970DepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationdel1961-1970Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_N2A_S1966C
Plasmid#98682PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with N2A and S1966CDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationN1775A, N1782A, S1966CAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Fgr-SH2-AviTag
Plasmid#214205PurposeBacterial expression of SH2 domain of the Fgr kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertFgr kinase SH2 domain (FGR Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET BiBRET Vector, NanoLuc-KRAS(G12V)_CRAF(RBD)-HaloTag
Plasmid#238572PurposeExpress NanoLuc-KRAS(G12V)_CRAF(RBD)-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12VPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCas-pML-1B_6xHis-Cas12m
Plasmid#192282PurposeMmCas12m fused to His-tag for protein purificationDepositorInsertMmCas12m
UseCRISPRTagsHis-tagExpressionBacterialPromoterT7Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianPromoterCAGAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V4-Puro
Plasmid#240290PurposeEncodes fourth generation porcine endogenous retrovirus-derived prime editing (pvPE) system with puromycin resistance gene into mammalian cells for gene editing.DepositorInsertpvPE-V4-Puro
UseCRISPRTagsSV40 NLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT309 RapInducible1-ActivatorCloneSite-Citrine
Plasmid#187321PurposeRapamycin inducible genetic circuit with cloning site for activator domainsDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pET28 His6-mEGFP-D4H
Plasmid#226373PurposeProduction of recombinant mEGFP-D4H, a fluorescent probe binding cholesterolDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME GFP-PCNA
Plasmid#105977Purposeentry clone for gateway cloning, cell cycle marker proliferative cell nuclear antigen PCNADepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC71171
Plasmid#154069PurposeLevel 0 Golden Gate vector, CRE with U5 intron at 254bp, in pICH41308 backboneDepositorInsertCRE_U5intron
UseSynthetic BiologyMutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AMPKsub-YPet-NES
Plasmid#84635PurposeEncodes C-terminal (substrate) fragment of bimolecular AMPK/BRSK activity reporter (bimABKAR); cytosol targeted; use in conjunction with pcDNA3-Cerulean-FHA1-NESDepositorInsertAMPKsub-YPet-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianPromoterCMVAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Hyg-FHIT
Plasmid#16410DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only