We narrowed to 2,369 results for: PUC19
-
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD424
Plasmid#178202PurposeExpression of Rok from the hns promoterDepositorInsertphns + rok
ExpressionBacterialPromoterhns promoterAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD410
Plasmid#178200PurposeExpression of sRok from the hns promoterDepositorInsertphns + srok
ExpressionBacterialPromoterhns promoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIALD2HMGr
Plasmid#185867PurposeKnocking out ALD6; expressing acetylating aldehyde dehydrogenase (Lactobacillus reuteri pduP and L. reuteri EutE) and an NADH-preferring HMG-CoA reductase (Delftia acidovorans mvaA) in S. cerevisiaeDepositorInsertALD6(-125, 40)> PSk.GAL1>Da.mvaA>TPGK1-PADH1> Lr.pduP> TPDC1-PGAL2>Lr.EutE-ALD6(1054, 1749)
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15545_dABE8e-SuperFi-Cas9
Plasmid#184375PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE8e base editorDepositorInsertdABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
Plasmid#178094PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and EBFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EBFP nick sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EGFP_Nick_Dual_sgRNA
Plasmid#178095PurposeControl vector for coselection for PE3b in human cells. Tandem expression of ATP1A1 G3 and EGFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EGFP nick sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only