We narrowed to 7,170 results for: GAN
-
Plasmid#185187PurposeFor the mammalian expression of the C. elegans protein A0A061ACN9_CAEEL. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertA0A061ACN9_CAEEL
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H9G2U1_CAEEL (pBS0346)
Plasmid#185185PurposeFor the mammalian expression of the C. elegans protein H9G2U1_CAEEL. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertH9G2U1_CAEEL
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H9G2T9_CAEEL (pBS0344)
Plasmid#185183PurposeFor the mammalian expression of the C. elegans protein H9G2T9_CAEEL. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertH9G2T9_CAEEL
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H9G2T8_CAEEL (pBS0342)
Plasmid#185182PurposeFor the mammalian expression of the C. elegans protein H9G2T8_CAEEL. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertH9G2T8_CAEEL
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H2FLK4_CAEEL (pBS0314)
Plasmid#185171PurposeFor the mammalian expression of the C. elegans protein H2FLK4_CAEEL. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertH2FLK4_CAEEL
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_G5EFU3_CAEEL (pBS0308)
Plasmid#185168PurposeFor the mammalian expression of the C. elegans protein G5EFU3_CAEEL. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertG5EFU3_CAEEL
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBT3038
Plasmid#122545PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a lysosomal related organelle localized gene (glo-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG#244
Plasmid#110927PurposeVector for expressing proteins in a subset of 9 DA/ DB cholingergic motor neurons in the C. elegans ventral nerve cordDepositorInsertsunc-129 promoter
unc-54 3' control region
ExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP996-1
Plasmid#99499Purpose3XFlag::meGFP::linker::TEVDepositorInsert3XFlag::meGFP::linker::TEV
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP686-1
Plasmid#99491PurposeTEV::eGFP::ER::V5::linker::3XFlagDepositorInsertTEV::eGFP::RE::V5::linker::3XFlag
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPD91_14
Plasmid#1472DepositorTypeEmpty backboneTagsunc54-204, unc545', IVSA, SV40NLS, gfpN, gfp…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pSJC316
Plasmid#245772PurposeAllows for rap-1(G12V)::mGFP entry into Gateway VectorsDepositorInsertrap-1(G12V)::mGFP
UseUnspecifiedTagsmGFPMutationG12VAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJC318
Plasmid#245774PurposeAllows for rac-2(G12V)::mGFP entry into Gateway VectorsDepositorInsertrac-2(G12V)::mGFP
UseUnspecifiedTagsmGFPMutationG12VAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJC320
Plasmid#245776PurposeExpresses rac-2::mGFP in cholinergic motor neuronsDepositorInsertrac-2::mGFP
TagsmGFPExpressionWormPromoterunc-17bAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBD30
Plasmid#245767PurposeExpresses rap-1::mCherry in cholinergic motor neuronsDepositorInsertrap-1::mCherry
TagsmCherryExpressionWormPromoterunc-17bAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBD34
Plasmid#245769PurposeExpresses tiam-1::mGFP in cholinergic motor neuronsDepositorInserttiam-1::mGFP
TagsmGFPExpressionWormPromoterunc-17bAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBD31
Plasmid#245768PurposeExpresses rap-1::mGFP in cholinergic motor neuronsDepositorInsertrap-1::mGFP
TagsmGFPExpressionWormPromoterunc-17bAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
IDH1_WT
Plasmid#224142PurposeIPTG-inducible expression of C. elegans protein IDH-1 with a chitin tagDepositorAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only