We narrowed to 78 results for: heyza
-
Plasmid#207083PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF169 locus.DepositorInsertHaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1 PST deletion
Plasmid#207109PurposepHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the PST repeat region in human cells.DepositorInsertHaloTag-MDC1 PST deletion
TagsHaloTagExpressionMammalianPromoterCMVAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1 BRCT domain deletion
Plasmid#207110PurposepHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the BRCT domain in human cells.DepositorInsertHaloTag-MDC1 BRCT domain deletion
TagsHaloTagExpressionMammalianPromoterCMVAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
HDR-HaloPOLQ
Plasmid#211637Purposehalo donorDepositorInsertPuro-LoxHaloTag
TagsflagExpressionMammalianPromoterSV40Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-DNAPKcs
Plasmid#210787PurposePlasmid for expression of HaloTag-DNA-PKcs in mammalian cellsDepositorInsertDNA-PKcs
Tags3xFLAG-HaloTagExpressionMammalianPromoterCMVAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 S141A (C)-C-Myc-DDK-P2A-Puro
Plasmid#211622PurposeRhno1 S141ADepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-POLQ-Halo
Plasmid#211636PurposesgRNA against POLQDepositorInsertsgRNA POLQ
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC1 gRNA1
Plasmid#211630PurposesgRNA-1 against ERCC1DepositorInsertsgRNA ERCC1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-CHMP4B gRNA2
Plasmid#211629PurposesgRNA-2 against CHMP4BDepositorInsertsgRNA CHMP4B
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only