We narrowed to 78 results for: heyza
-
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM-Halo HRD
Plasmid#207082PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous ATM locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterNoneAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-DNAPKcs HRD
Plasmid#207088PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous DNA-PKcs locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168-Halo HRD
Plasmid#207080PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF168 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
UseTagsExpressionMammalianMutationPromoterNoneAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1-Halo HRD
Plasmid#207084PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous NBS1 locus.DepositorInsertHaloTag followed by a LoxP-PuroR cassette flanked by human NBS1 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterNoneAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rev7-Halo HRD
Plasmid#207079PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous REV7 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterNoneAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1 HRD
Plasmid#207086PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous MDC1 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human MDC1 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rif1-Halo HRD
Plasmid#207081PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterNoneAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1 PST deletion
Plasmid#207109PurposepHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the PST repeat region in human cells.DepositorInsertHaloTag-MDC1 PST deletion
UseTagsHaloTagExpressionMammalianMutationPromoterCMVAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169-Halo HRD
Plasmid#207083PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF169 locus.DepositorInsertHaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1 BRCT domain deletion
Plasmid#207110PurposepHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the BRCT domain in human cells.DepositorInsertHaloTag-MDC1 BRCT domain deletion
UseTagsHaloTagExpressionMammalianMutationPromoterCMVAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
HDR-HaloPOLQ
Plasmid#211637Purposehalo donorDepositorInsertPuro-LoxHaloTag
UseTagsflagExpressionMammalianMutationPromoterSV40Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-CHMP4B gRNA2
Plasmid#211629PurposesgRNA-2 against CHMP4BDepositorInsertsgRNA CHMP4B
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-CHMP4B gRNA1
Plasmid#211628PurposesgRNA-1 against CHMP4BDepositorInsertsgRNA CHMP4B
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-POLQ-Halo
Plasmid#211636PurposesgRNA against POLQDepositorInsertsgRNA POLQ
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC1 gRNA1
Plasmid#211630PurposesgRNA-1 against ERCC1DepositorInsertsgRNA ERCC1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC6L gRNA2
Plasmid#211633PurposesgRNA-2 agsinst ERCC6LDepositorInsertsgRNA ERCC6L
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only